Multiple sequence alignment - TraesCS4B01G146100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G146100 chr4B 100.000 2465 0 0 1 2465 209105581 209108045 0.000000e+00 4553
1 TraesCS4B01G146100 chr4B 98.413 315 4 1 2151 2465 495478517 495478204 9.960000e-154 553
2 TraesCS4B01G146100 chr3B 98.422 2154 31 2 1 2154 92297809 92295659 0.000000e+00 3786
3 TraesCS4B01G146100 chr3B 98.048 2152 42 0 1 2152 6011843 6009692 0.000000e+00 3742
4 TraesCS4B01G146100 chr4D 98.329 2154 36 0 1 2154 123450063 123447910 0.000000e+00 3779
5 TraesCS4B01G146100 chr3A 98.329 2154 36 0 1 2154 495105837 495103684 0.000000e+00 3779
6 TraesCS4B01G146100 chr2B 98.050 2154 42 0 1 2154 234542237 234540084 0.000000e+00 3746
7 TraesCS4B01G146100 chr2B 98.413 315 5 0 2151 2465 234539965 234539651 2.770000e-154 555
8 TraesCS4B01G146100 chrUn 98.048 2152 42 0 1 2152 217906591 217908742 0.000000e+00 3742
9 TraesCS4B01G146100 chr7A 98.004 2154 43 0 1 2154 563523175 563521022 0.000000e+00 3740
10 TraesCS4B01G146100 chr4A 97.957 2154 44 0 1 2154 67518421 67520574 0.000000e+00 3735
11 TraesCS4B01G146100 chr6D 97.864 2154 44 2 1 2154 458942429 458940278 0.000000e+00 3722
12 TraesCS4B01G146100 chr6D 98.095 315 6 0 2151 2465 108486403 108486717 1.290000e-152 549
13 TraesCS4B01G146100 chr6A 98.730 315 4 0 2151 2465 597251801 597251487 5.950000e-156 560
14 TraesCS4B01G146100 chr1A 98.730 315 4 0 2151 2465 22561538 22561852 5.950000e-156 560
15 TraesCS4B01G146100 chr7D 98.095 315 6 0 2151 2465 307041256 307041570 1.290000e-152 549
16 TraesCS4B01G146100 chr7D 98.095 315 6 0 2151 2465 307145429 307145115 1.290000e-152 549
17 TraesCS4B01G146100 chr3D 97.778 315 7 0 2151 2465 213391170 213390856 6.000000e-151 544
18 TraesCS4B01G146100 chr3D 97.778 315 7 0 2151 2465 523753885 523754199 6.000000e-151 544


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G146100 chr4B 209105581 209108045 2464 False 4553.0 4553 100.0000 1 2465 1 chr4B.!!$F1 2464
1 TraesCS4B01G146100 chr3B 92295659 92297809 2150 True 3786.0 3786 98.4220 1 2154 1 chr3B.!!$R2 2153
2 TraesCS4B01G146100 chr3B 6009692 6011843 2151 True 3742.0 3742 98.0480 1 2152 1 chr3B.!!$R1 2151
3 TraesCS4B01G146100 chr4D 123447910 123450063 2153 True 3779.0 3779 98.3290 1 2154 1 chr4D.!!$R1 2153
4 TraesCS4B01G146100 chr3A 495103684 495105837 2153 True 3779.0 3779 98.3290 1 2154 1 chr3A.!!$R1 2153
5 TraesCS4B01G146100 chr2B 234539651 234542237 2586 True 2150.5 3746 98.2315 1 2465 2 chr2B.!!$R1 2464
6 TraesCS4B01G146100 chrUn 217906591 217908742 2151 False 3742.0 3742 98.0480 1 2152 1 chrUn.!!$F1 2151
7 TraesCS4B01G146100 chr7A 563521022 563523175 2153 True 3740.0 3740 98.0040 1 2154 1 chr7A.!!$R1 2153
8 TraesCS4B01G146100 chr4A 67518421 67520574 2153 False 3735.0 3735 97.9570 1 2154 1 chr4A.!!$F1 2153
9 TraesCS4B01G146100 chr6D 458940278 458942429 2151 True 3722.0 3722 97.8640 1 2154 1 chr6D.!!$R1 2153

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
732 733 0.40404 TTCCTTCGGTTTGGCTCCAT 59.596 50.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1877 1878 0.804989 CGGCCTTCGCTTTTTGAGAT 59.195 50.0 0.0 0.0 34.44 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 181 2.418628 CCGCTTTGATAACCGTGTGAAT 59.581 45.455 0.00 0.00 0.00 2.57
182 183 3.171277 GCTTTGATAACCGTGTGAATGC 58.829 45.455 0.00 0.00 0.00 3.56
191 192 0.603707 CGTGTGAATGCAGAGTGGGT 60.604 55.000 0.00 0.00 0.00 4.51
283 284 1.489649 GAGTAAACTCCCTTAGGGCCC 59.510 57.143 16.46 16.46 43.94 5.80
374 375 9.582648 AAAAAGAAAGGCAGAGGTAAATACTTA 57.417 29.630 0.00 0.00 0.00 2.24
616 617 1.525306 GGCCCGGAAATAGAACCCG 60.525 63.158 0.73 0.00 42.64 5.28
634 635 1.076705 GGCCCCCTTTCTGATCCAC 60.077 63.158 0.00 0.00 0.00 4.02
732 733 0.404040 TTCCTTCGGTTTGGCTCCAT 59.596 50.000 0.00 0.00 0.00 3.41
902 903 2.550606 GTGACCTTATTGCACGGTTCAA 59.449 45.455 0.00 0.00 0.00 2.69
938 939 3.398406 TGTGATGCAAGTGAACGTGTAT 58.602 40.909 0.00 0.10 34.06 2.29
1145 1146 3.812053 GCTTCAACTACTCATGCTATGGG 59.188 47.826 0.00 0.00 36.61 4.00
1273 1274 0.478072 TGGTGGAGTGGCACAAGATT 59.522 50.000 21.41 0.00 44.16 2.40
1377 1378 1.467342 GGCAACCGTATCTGGAAACAC 59.533 52.381 0.00 0.00 35.60 3.32
1683 1684 1.694856 GGGTGGGCCATCAACCTTA 59.305 57.895 20.42 0.00 41.18 2.69
1718 1719 2.419574 CCTACGGACCGTGAATGGATTT 60.420 50.000 29.55 0.22 41.39 2.17
1877 1878 5.529289 ACATAGAGATGTGGGTAGAGGAAA 58.471 41.667 0.00 0.00 44.90 3.13
2202 2325 3.391965 GCATCTGAGAATGATTCGAGCT 58.608 45.455 0.00 0.00 34.02 4.09
2220 2343 2.912956 AGCTGTATGAAGGGAAACTCCA 59.087 45.455 0.00 0.00 38.64 3.86
2384 2507 5.123820 CACCTTACGATGTTCATGACCAATT 59.876 40.000 0.00 0.00 0.00 2.32
2391 2514 5.505159 CGATGTTCATGACCAATTGGATCTG 60.505 44.000 31.22 21.33 38.94 2.90
2441 2564 4.089341 CGCTATGATCGTTACTGTATCCG 58.911 47.826 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 181 1.055849 TTTGCTCTACCCACTCTGCA 58.944 50.000 0.0 0.0 0.00 4.41
182 183 2.616510 CCCTTTTGCTCTACCCACTCTG 60.617 54.545 0.0 0.0 0.00 3.35
191 192 2.572104 GACCTCCTTCCCTTTTGCTCTA 59.428 50.000 0.0 0.0 0.00 2.43
219 220 1.300931 GCTCAAGTGTGCGACTCCA 60.301 57.895 0.0 0.0 31.73 3.86
242 243 0.119155 ACCCATTCTCCAGTCTCCCA 59.881 55.000 0.0 0.0 0.00 4.37
283 284 6.727824 AAGTTCCTCGTCTGTGATTTAATG 57.272 37.500 0.0 0.0 0.00 1.90
374 375 2.044252 TACCGAGCCGCCTCTTCT 60.044 61.111 0.0 0.0 35.90 2.85
616 617 1.076705 GTGGATCAGAAAGGGGGCC 60.077 63.158 0.0 0.0 0.00 5.80
634 635 0.179171 CGCCTGCTTGCAGAAATGAG 60.179 55.000 22.5 7.0 0.00 2.90
902 903 3.438087 GCATCACATACACAAGTGCTCTT 59.562 43.478 0.0 0.0 35.76 2.85
938 939 5.163834 ACGAAACTTTACGACAGCTTTTTCA 60.164 36.000 0.0 0.0 0.00 2.69
1377 1378 6.097915 ACAGTACCAATATCCACTAATCGG 57.902 41.667 0.0 0.0 0.00 4.18
1683 1684 2.762535 CGTAGGACCAACACCATTCT 57.237 50.000 0.0 0.0 0.00 2.40
1877 1878 0.804989 CGGCCTTCGCTTTTTGAGAT 59.195 50.000 0.0 0.0 34.44 2.75
2202 2325 3.071892 ACGTTGGAGTTTCCCTTCATACA 59.928 43.478 0.0 0.0 35.03 2.29
2220 2343 2.427812 CCCCCAAAACAAACTGTACGTT 59.572 45.455 0.0 0.0 37.47 3.99
2441 2564 5.554636 CACTTTGTCGCATCTCTTCAATAC 58.445 41.667 0.0 0.0 0.00 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.