Multiple sequence alignment - TraesCS4B01G145800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G145800 chr4B 100.000 2255 0 0 1 2255 209079334 209077080 0 4165
1 TraesCS4B01G145800 chr1D 98.936 2256 22 2 1 2255 141314952 141312698 0 4032
2 TraesCS4B01G145800 chr7B 98.892 2257 23 1 1 2255 644465626 644467882 0 4028
3 TraesCS4B01G145800 chr3A 98.759 2256 27 1 1 2255 633109437 633111692 0 4010
4 TraesCS4B01G145800 chr7A 98.715 2256 28 1 1 2255 60150104 60147849 0 4004
5 TraesCS4B01G145800 chr7A 97.781 2253 48 2 4 2255 46399060 46396809 0 3882
6 TraesCS4B01G145800 chr6B 98.537 2256 32 1 1 2255 306997807 306995552 0 3982
7 TraesCS4B01G145800 chr2B 97.962 2257 39 4 1 2255 391114653 391112402 0 3906


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G145800 chr4B 209077080 209079334 2254 True 4165 4165 100.000 1 2255 1 chr4B.!!$R1 2254
1 TraesCS4B01G145800 chr1D 141312698 141314952 2254 True 4032 4032 98.936 1 2255 1 chr1D.!!$R1 2254
2 TraesCS4B01G145800 chr7B 644465626 644467882 2256 False 4028 4028 98.892 1 2255 1 chr7B.!!$F1 2254
3 TraesCS4B01G145800 chr3A 633109437 633111692 2255 False 4010 4010 98.759 1 2255 1 chr3A.!!$F1 2254
4 TraesCS4B01G145800 chr7A 60147849 60150104 2255 True 4004 4004 98.715 1 2255 1 chr7A.!!$R2 2254
5 TraesCS4B01G145800 chr7A 46396809 46399060 2251 True 3882 3882 97.781 4 2255 1 chr7A.!!$R1 2251
6 TraesCS4B01G145800 chr6B 306995552 306997807 2255 True 3982 3982 98.537 1 2255 1 chr6B.!!$R1 2254
7 TraesCS4B01G145800 chr2B 391112402 391114653 2251 True 3906 3906 97.962 1 2255 1 chr2B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
193 194 2.938428 AGACCCTTCATCTGACCTCT 57.062 50.0 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1904 1907 0.305922 CAATCATTCCGAAGAGCCGC 59.694 55.0 0.0 0.0 0.0 6.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 2.938428 AGACCCTTCATCTGACCTCT 57.062 50.000 0.00 0.00 0.00 3.69
194 195 4.282496 GAAGACCCTTCATCTGACCTCTA 58.718 47.826 2.14 0.00 0.00 2.43
566 567 6.896860 AGAGCAGTAGCATATTCATAGGAGAT 59.103 38.462 0.00 0.00 45.49 2.75
719 720 5.808042 TCAGATCATTCAACTAAAGCTGC 57.192 39.130 0.00 0.00 0.00 5.25
878 881 8.201242 AGTATATTTCCCTTCTCCATTCTCTC 57.799 38.462 0.00 0.00 0.00 3.20
1039 1042 3.243367 CCAAAAAGTCAAAGATGGCGTCA 60.243 43.478 9.78 0.00 35.88 4.35
1364 1367 0.618458 CAGGGCAGGCTTTAGGTACA 59.382 55.000 0.00 0.00 0.00 2.90
1499 1502 6.992715 TCAGTCTCCTCTTTTTCTTTTAGGTG 59.007 38.462 0.00 0.00 0.00 4.00
1652 1655 1.226030 AACGCACGCCCTGTAGTTTC 61.226 55.000 0.00 0.00 29.68 2.78
1666 1669 6.371825 CCCTGTAGTTTCGAAGCTAAAAAGAT 59.628 38.462 21.34 0.00 0.00 2.40
1866 1869 1.848886 AACTGATTCACCCGGGTCCC 61.849 60.000 27.51 13.58 0.00 4.46
1904 1907 7.235430 AGCTAATTTTTCCTTTACGAGATCG 57.765 36.000 0.00 0.00 46.33 3.69
2122 2126 1.202154 CGCTCACAGTAGTTCTACCCG 60.202 57.143 6.39 1.94 0.00 5.28
2148 2152 5.296283 AGAAAAGATCATGAAAGAGGCGATG 59.704 40.000 0.00 0.00 0.00 3.84
2250 2254 3.133721 CCCTCAGACGGATCAAAGAAGAT 59.866 47.826 0.00 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 5.765576 TTTACAATTGACAGGGTAGCCTA 57.234 39.130 14.41 0.00 0.00 3.93
194 195 4.650972 TTTACAATTGACAGGGTAGCCT 57.349 40.909 13.59 7.93 0.00 4.58
566 567 7.816031 CGGGACTACTAATTTCAAGTACAAAGA 59.184 37.037 0.00 0.00 0.00 2.52
1499 1502 1.254026 GGTTGGGGAACTGCTAAACC 58.746 55.000 0.00 0.00 0.00 3.27
1652 1655 3.551890 TCGCTGCTATCTTTTTAGCTTCG 59.448 43.478 0.00 7.86 44.03 3.79
1904 1907 0.305922 CAATCATTCCGAAGAGCCGC 59.694 55.000 0.00 0.00 0.00 6.53
2012 2015 3.055328 TCAATTGATAGATCAGGGCCCA 58.945 45.455 27.56 3.72 38.19 5.36
2122 2126 5.812642 TCGCCTCTTTCATGATCTTTTCTAC 59.187 40.000 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.