Multiple sequence alignment - TraesCS4B01G133800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G133800 chr4B 100.000 3830 0 0 1 3830 173393420 173389591 0 7073
1 TraesCS4B01G133800 chr4B 96.518 3848 101 15 1 3830 89440493 89436661 0 6333
2 TraesCS4B01G133800 chr4B 96.363 3822 116 12 1 3803 629506241 629510058 0 6266
3 TraesCS4B01G133800 chr4B 96.153 3847 111 13 1 3830 199607601 199611427 0 6250
4 TraesCS4B01G133800 chr4B 95.817 3849 124 14 1 3830 30501929 30505759 0 6181
5 TraesCS4B01G133800 chr4B 89.580 2169 165 31 1691 3824 461378043 461380185 0 2697
6 TraesCS4B01G133800 chr3B 97.011 3847 95 9 1 3830 646354832 646358675 0 6449
7 TraesCS4B01G133800 chr3B 96.589 3841 110 11 1 3824 656109232 656105396 0 6348
8 TraesCS4B01G133800 chr3B 96.535 3579 119 5 255 3830 420625463 420629039 0 5917
9 TraesCS4B01G133800 chr2B 96.608 3862 95 15 1 3830 514553050 514549193 0 6373
10 TraesCS4B01G133800 chr2B 96.674 3849 99 11 1 3830 123382169 123386007 0 6372
11 TraesCS4B01G133800 chr7B 96.483 3839 123 11 1 3830 330126037 330129872 0 6331
12 TraesCS4B01G133800 chr7B 96.812 3795 91 10 52 3830 192829159 192825379 0 6311
13 TraesCS4B01G133800 chr7B 94.555 2167 87 14 1691 3830 463805842 463808004 0 3319
14 TraesCS4B01G133800 chr7B 91.540 2163 129 28 1691 3824 34078645 34080782 0 2931
15 TraesCS4B01G133800 chr7B 91.135 2132 139 32 1691 3807 534862133 534864229 0 2844
16 TraesCS4B01G133800 chr7B 90.296 2164 157 27 1691 3825 214355069 214357208 0 2784
17 TraesCS4B01G133800 chr1B 96.276 3840 118 10 1 3824 575067001 575063171 0 6276
18 TraesCS4B01G133800 chr1B 94.523 3871 169 24 1 3830 84522058 84518190 0 5934
19 TraesCS4B01G133800 chr5B 96.023 3847 133 9 1 3830 519961574 519957731 0 6239
20 TraesCS4B01G133800 chr5B 96.539 2398 57 13 1456 3830 358455054 358452660 0 3945
21 TraesCS4B01G133800 chr6B 91.782 2166 132 22 1691 3830 25486938 25489083 0 2972
22 TraesCS4B01G133800 chr3D 88.307 2138 176 48 1691 3790 421481165 421483266 0 2495
23 TraesCS4B01G133800 chr4D 92.548 1154 79 7 1694 2844 144578054 144576905 0 1648


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G133800 chr4B 173389591 173393420 3829 True 7073 7073 100.000 1 3830 1 chr4B.!!$R2 3829
1 TraesCS4B01G133800 chr4B 89436661 89440493 3832 True 6333 6333 96.518 1 3830 1 chr4B.!!$R1 3829
2 TraesCS4B01G133800 chr4B 629506241 629510058 3817 False 6266 6266 96.363 1 3803 1 chr4B.!!$F4 3802
3 TraesCS4B01G133800 chr4B 199607601 199611427 3826 False 6250 6250 96.153 1 3830 1 chr4B.!!$F2 3829
4 TraesCS4B01G133800 chr4B 30501929 30505759 3830 False 6181 6181 95.817 1 3830 1 chr4B.!!$F1 3829
5 TraesCS4B01G133800 chr4B 461378043 461380185 2142 False 2697 2697 89.580 1691 3824 1 chr4B.!!$F3 2133
6 TraesCS4B01G133800 chr3B 646354832 646358675 3843 False 6449 6449 97.011 1 3830 1 chr3B.!!$F2 3829
7 TraesCS4B01G133800 chr3B 656105396 656109232 3836 True 6348 6348 96.589 1 3824 1 chr3B.!!$R1 3823
8 TraesCS4B01G133800 chr3B 420625463 420629039 3576 False 5917 5917 96.535 255 3830 1 chr3B.!!$F1 3575
9 TraesCS4B01G133800 chr2B 514549193 514553050 3857 True 6373 6373 96.608 1 3830 1 chr2B.!!$R1 3829
10 TraesCS4B01G133800 chr2B 123382169 123386007 3838 False 6372 6372 96.674 1 3830 1 chr2B.!!$F1 3829
11 TraesCS4B01G133800 chr7B 330126037 330129872 3835 False 6331 6331 96.483 1 3830 1 chr7B.!!$F3 3829
12 TraesCS4B01G133800 chr7B 192825379 192829159 3780 True 6311 6311 96.812 52 3830 1 chr7B.!!$R1 3778
13 TraesCS4B01G133800 chr7B 463805842 463808004 2162 False 3319 3319 94.555 1691 3830 1 chr7B.!!$F4 2139
14 TraesCS4B01G133800 chr7B 34078645 34080782 2137 False 2931 2931 91.540 1691 3824 1 chr7B.!!$F1 2133
15 TraesCS4B01G133800 chr7B 534862133 534864229 2096 False 2844 2844 91.135 1691 3807 1 chr7B.!!$F5 2116
16 TraesCS4B01G133800 chr7B 214355069 214357208 2139 False 2784 2784 90.296 1691 3825 1 chr7B.!!$F2 2134
17 TraesCS4B01G133800 chr1B 575063171 575067001 3830 True 6276 6276 96.276 1 3824 1 chr1B.!!$R2 3823
18 TraesCS4B01G133800 chr1B 84518190 84522058 3868 True 5934 5934 94.523 1 3830 1 chr1B.!!$R1 3829
19 TraesCS4B01G133800 chr5B 519957731 519961574 3843 True 6239 6239 96.023 1 3830 1 chr5B.!!$R2 3829
20 TraesCS4B01G133800 chr5B 358452660 358455054 2394 True 3945 3945 96.539 1456 3830 1 chr5B.!!$R1 2374
21 TraesCS4B01G133800 chr6B 25486938 25489083 2145 False 2972 2972 91.782 1691 3830 1 chr6B.!!$F1 2139
22 TraesCS4B01G133800 chr3D 421481165 421483266 2101 False 2495 2495 88.307 1691 3790 1 chr3D.!!$F1 2099
23 TraesCS4B01G133800 chr4D 144576905 144578054 1149 True 1648 1648 92.548 1694 2844 1 chr4D.!!$R1 1150

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
367 372 2.159612 CGCACCACTCTGACATCAAATG 60.160 50.000 0.0 0.0 0.0 2.32 F
1176 1206 1.302033 CAGCGAACCAGACAAGGCT 60.302 57.895 0.0 0.0 0.0 4.58 F
1186 1216 0.534412 AGACAAGGCTGACGAGATGG 59.466 55.000 0.0 0.0 0.0 3.51 F
1195 1225 0.611896 TGACGAGATGGTGAGCAGGA 60.612 55.000 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1176 1206 0.611896 TCCTGCTCACCATCTCGTCA 60.612 55.000 0.00 0.00 0.00 4.35 R
2743 2824 1.946768 CCAACCTGTCACGATGTTGTT 59.053 47.619 0.00 0.00 37.08 2.83 R
2804 2885 2.270923 CATCTTCATCCGCGAAGTTGA 58.729 47.619 8.23 1.47 41.89 3.18 R
2897 2979 7.429920 TCAACATAACGAAAGCAAACTACAAAC 59.570 33.333 0.00 0.00 0.00 2.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 372 2.159612 CGCACCACTCTGACATCAAATG 60.160 50.000 0.00 0.00 0.00 2.32
1176 1206 1.302033 CAGCGAACCAGACAAGGCT 60.302 57.895 0.00 0.00 0.00 4.58
1186 1216 0.534412 AGACAAGGCTGACGAGATGG 59.466 55.000 0.00 0.00 0.00 3.51
1195 1225 0.611896 TGACGAGATGGTGAGCAGGA 60.612 55.000 0.00 0.00 0.00 3.86
1367 1397 4.922206 TGGTGAGCAATCCTACTCATTTT 58.078 39.130 0.00 0.00 44.29 1.82
2728 2809 3.198680 GCATACGCAACGTACAAGC 57.801 52.632 1.43 4.00 45.07 4.01
2743 2824 3.159213 ACAAGCCATGGAAGACAATCA 57.841 42.857 18.40 0.00 0.00 2.57
2804 2885 1.569653 GCTGACCCCTACTACCACTT 58.430 55.000 0.00 0.00 0.00 3.16
2897 2979 6.485313 TGTGTCCTTAGTATTGTTGTTTCAGG 59.515 38.462 0.00 0.00 0.00 3.86
3152 3344 6.633856 CAGACTAAATAAAGGCCAAAAGCAT 58.366 36.000 5.01 0.00 46.50 3.79
3205 3397 8.687292 TTAGACATGAACGGTAGTACTATCAT 57.313 34.615 13.53 11.49 0.00 2.45
3340 3536 3.960571 AGTACTGCATCAGGAAAAGCAT 58.039 40.909 0.00 0.00 36.28 3.79
3386 3583 5.013287 CCTAGTCACTAGCATCCTAGGACTA 59.987 48.000 15.42 11.14 44.96 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 372 0.031994 AAACAGCGCATGGGTTTGAC 59.968 50.000 11.47 0.79 33.78 3.18
739 763 1.505425 GCGTGGAAGAACTAACCGTT 58.495 50.000 0.00 0.00 38.91 4.44
882 912 6.625700 AGGGAGAGATATAAGAAAATGGGGTT 59.374 38.462 0.00 0.00 0.00 4.11
996 1026 4.115199 GGTTCCTCCGCCATGGCT 62.115 66.667 33.07 0.00 39.32 4.75
1176 1206 0.611896 TCCTGCTCACCATCTCGTCA 60.612 55.000 0.00 0.00 0.00 4.35
1186 1216 2.485124 CCTTCATCCTGATCCTGCTCAC 60.485 54.545 0.00 0.00 0.00 3.51
1195 1225 1.414061 CCGCCTCCCTTCATCCTGAT 61.414 60.000 0.00 0.00 0.00 2.90
1302 1332 1.131638 ACACCAAGCAGAGTTCCTCA 58.868 50.000 0.00 0.00 32.06 3.86
1367 1397 5.387113 AACAGATAAACCATATGCAGGGA 57.613 39.130 8.67 0.00 28.26 4.20
2124 2177 6.370593 CGCTGCTTGATTCAAGTTTAGTTTA 58.629 36.000 23.66 4.32 42.77 2.01
2492 2569 3.660501 GGTTGATTTCCAAACCAGACC 57.339 47.619 0.00 0.00 36.47 3.85
2728 2809 4.852134 TGTTGTTGATTGTCTTCCATGG 57.148 40.909 4.97 4.97 0.00 3.66
2743 2824 1.946768 CCAACCTGTCACGATGTTGTT 59.053 47.619 0.00 0.00 37.08 2.83
2804 2885 2.270923 CATCTTCATCCGCGAAGTTGA 58.729 47.619 8.23 1.47 41.89 3.18
2897 2979 7.429920 TCAACATAACGAAAGCAAACTACAAAC 59.570 33.333 0.00 0.00 0.00 2.93
3300 3496 9.085250 GCAGTACTTAGTGAATTTCTAACTACC 57.915 37.037 0.00 0.00 0.00 3.18
3340 3536 5.011329 AGGAAATACGTACTGGTGTTTCTCA 59.989 40.000 16.67 0.00 43.41 3.27
3386 3583 5.708230 TGTGTTCAACTGTACCAGAACTTTT 59.292 36.000 14.00 0.00 40.62 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.