Multiple sequence alignment - TraesCS4B01G127000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G127000 chr4B 100.000 2375 0 0 1 2375 165971510 165969136 0 4386
1 TraesCS4B01G127000 chr4B 93.721 2389 131 10 1 2375 485379990 485382373 0 3563
2 TraesCS4B01G127000 chr7B 94.036 2381 133 8 1 2375 518289868 518287491 0 3602
3 TraesCS4B01G127000 chr7B 93.824 2380 140 6 1 2375 518305877 518303500 0 3574
4 TraesCS4B01G127000 chr7B 86.882 1174 123 16 1 1168 638611594 638610446 0 1286
5 TraesCS4B01G127000 chr5B 92.215 2248 131 26 1 2216 274671509 274673744 0 3142
6 TraesCS4B01G127000 chr6B 89.588 2401 208 29 1 2375 105723557 105725941 0 3011
7 TraesCS4B01G127000 chr6B 85.476 1198 141 19 1 1191 561743408 561742237 0 1218
8 TraesCS4B01G127000 chr2A 89.061 2386 221 21 1 2375 82414375 82412019 0 2924
9 TraesCS4B01G127000 chr3A 88.684 2386 231 20 1 2375 167683304 167680947 0 2874
10 TraesCS4B01G127000 chr3A 87.861 2389 263 21 1 2375 46666727 46664352 0 2780
11 TraesCS4B01G127000 chr1B 88.298 2068 211 26 324 2375 260841935 260839883 0 2449
12 TraesCS4B01G127000 chr7A 84.958 2400 302 37 1 2375 592894961 592897326 0 2377
13 TraesCS4B01G127000 chr3B 94.467 1229 60 5 1155 2375 398774280 398775508 0 1886


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G127000 chr4B 165969136 165971510 2374 True 4386 4386 100.000 1 2375 1 chr4B.!!$R1 2374
1 TraesCS4B01G127000 chr4B 485379990 485382373 2383 False 3563 3563 93.721 1 2375 1 chr4B.!!$F1 2374
2 TraesCS4B01G127000 chr7B 518287491 518289868 2377 True 3602 3602 94.036 1 2375 1 chr7B.!!$R1 2374
3 TraesCS4B01G127000 chr7B 518303500 518305877 2377 True 3574 3574 93.824 1 2375 1 chr7B.!!$R2 2374
4 TraesCS4B01G127000 chr7B 638610446 638611594 1148 True 1286 1286 86.882 1 1168 1 chr7B.!!$R3 1167
5 TraesCS4B01G127000 chr5B 274671509 274673744 2235 False 3142 3142 92.215 1 2216 1 chr5B.!!$F1 2215
6 TraesCS4B01G127000 chr6B 105723557 105725941 2384 False 3011 3011 89.588 1 2375 1 chr6B.!!$F1 2374
7 TraesCS4B01G127000 chr6B 561742237 561743408 1171 True 1218 1218 85.476 1 1191 1 chr6B.!!$R1 1190
8 TraesCS4B01G127000 chr2A 82412019 82414375 2356 True 2924 2924 89.061 1 2375 1 chr2A.!!$R1 2374
9 TraesCS4B01G127000 chr3A 167680947 167683304 2357 True 2874 2874 88.684 1 2375 1 chr3A.!!$R2 2374
10 TraesCS4B01G127000 chr3A 46664352 46666727 2375 True 2780 2780 87.861 1 2375 1 chr3A.!!$R1 2374
11 TraesCS4B01G127000 chr1B 260839883 260841935 2052 True 2449 2449 88.298 324 2375 1 chr1B.!!$R1 2051
12 TraesCS4B01G127000 chr7A 592894961 592897326 2365 False 2377 2377 84.958 1 2375 1 chr7A.!!$F1 2374
13 TraesCS4B01G127000 chr3B 398774280 398775508 1228 False 1886 1886 94.467 1155 2375 1 chr3B.!!$F1 1220

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
790 806 0.61326 TGTACTCGAAGCCAAGGCAT 59.387 50.0 14.4 0.0 44.88 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2179 2255 2.100916 CGAAGGAACATACCACCGATCT 59.899 50.0 0.0 0.0 32.1 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 1.390463 CGGCAGCGAGAAGTAGTTTTC 59.610 52.381 0.00 0.0 0.00 2.29
101 102 2.951642 TGCTCCTACTTGCCATATTTGC 59.048 45.455 0.00 0.0 0.00 3.68
110 111 4.081752 ACTTGCCATATTTGCGGATTTCAA 60.082 37.500 0.00 0.0 0.00 2.69
362 363 6.578023 ACAGTCTTATTCAGCTCCTATTCAC 58.422 40.000 0.00 0.0 0.00 3.18
665 675 9.809096 AGTACTATATCATCACAGTTTGAGTTG 57.191 33.333 0.00 0.0 37.77 3.16
700 710 8.198807 TGAGATATCCATTGATACATGTGAGT 57.801 34.615 9.11 0.0 36.32 3.41
735 745 6.045318 GTCACATTTAGCTGAGCAAGATAGA 58.955 40.000 7.39 0.0 0.00 1.98
790 806 0.613260 TGTACTCGAAGCCAAGGCAT 59.387 50.000 14.40 0.0 44.88 4.40
802 818 3.117398 AGCCAAGGCATAAGATGATCCAA 60.117 43.478 14.40 0.0 44.88 3.53
809 825 4.215827 GGCATAAGATGATCCAAAGCTCAG 59.784 45.833 0.00 0.0 0.00 3.35
902 918 5.738909 TGAAGATGAAGAACCTGAGATTCC 58.261 41.667 0.00 0.0 0.00 3.01
1328 1344 3.402110 CACTACATGCTGACCAAGTTCA 58.598 45.455 0.00 0.0 0.00 3.18
1406 1426 3.518705 AGGAGCACACATGAAGAGAGAAT 59.481 43.478 0.00 0.0 0.00 2.40
1551 1600 8.777865 ACCATCATACATTATACATGCTGTAC 57.222 34.615 0.00 0.0 35.42 2.90
1644 1694 7.064866 AGGGTGATTGATGTGAATATGTGAAT 58.935 34.615 0.00 0.0 0.00 2.57
2104 2168 2.061509 TACCATGTTCTCGGGATCGA 57.938 50.000 0.00 0.0 43.86 3.59
2129 2193 2.656947 TGTTCCTTTGGGGAGACAAG 57.343 50.000 0.00 0.0 46.01 3.16
2179 2255 5.593095 AGCCAAGTGTATACTATGTTCTCGA 59.407 40.000 4.17 0.0 35.69 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 3.188873 CGTAAGAACTAGGCCTATCCTCG 59.811 52.174 14.30 9.85 42.96 4.63
101 102 0.248621 GCGAATGGCCTTGAAATCCG 60.249 55.000 3.32 0.00 34.80 4.18
123 124 0.608130 TAGCCACGCTGACATTCAGT 59.392 50.000 5.14 0.00 45.94 3.41
186 187 9.461312 TGAGTAATTGTTTTGGTATGAGCTATT 57.539 29.630 0.00 0.00 0.00 1.73
362 363 4.038522 CACATCTCCTGGTGTAGAGGTATG 59.961 50.000 1.53 0.00 34.74 2.39
665 675 2.042464 TGGATATCTCAGCCACACTCC 58.958 52.381 2.05 0.00 37.95 3.85
700 710 3.003897 GCTAAATGTGACGGTGTTGGAAA 59.996 43.478 0.00 0.00 0.00 3.13
735 745 1.006813 TCTCTTCCTCTGGGCTCTCT 58.993 55.000 0.00 0.00 0.00 3.10
790 806 5.061853 GCATCTGAGCTTTGGATCATCTTA 58.938 41.667 0.00 0.00 37.24 2.10
802 818 0.694771 TCACTTGGGCATCTGAGCTT 59.305 50.000 0.00 0.00 34.17 3.74
809 825 3.084039 TCAACTTGATCACTTGGGCATC 58.916 45.455 10.92 0.00 0.00 3.91
902 918 5.503031 CGCTCTTGTATGACAATAGGCAAAG 60.503 44.000 6.80 0.00 37.48 2.77
1328 1344 1.566231 GGTCCCAGGGAATGTCATCTT 59.434 52.381 10.89 0.00 31.38 2.40
1406 1426 2.103771 GCTTCCTCATACATGCTCCAGA 59.896 50.000 0.00 0.00 0.00 3.86
1551 1600 1.398390 GCGACCCAAATAGCAGTTGAG 59.602 52.381 0.00 0.00 0.00 3.02
1644 1694 5.359576 AGTTTACAAGGCATTCAACACTCAA 59.640 36.000 0.00 0.00 0.00 3.02
2104 2168 3.053619 GTCTCCCCAAAGGAACATACCAT 60.054 47.826 0.00 0.00 46.94 3.55
2169 2245 2.651455 ACCACCGATCTCGAGAACATA 58.349 47.619 20.91 0.00 43.02 2.29
2179 2255 2.100916 CGAAGGAACATACCACCGATCT 59.899 50.000 0.00 0.00 32.10 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.