Multiple sequence alignment - TraesCS4B01G125600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G125600 chr4B 100.000 2979 0 0 1 2979 156061820 156064798 0.000000e+00 5502
1 TraesCS4B01G125600 chr5A 99.258 2157 16 0 823 2979 580486284 580484128 0.000000e+00 3895
2 TraesCS4B01G125600 chr5A 99.516 827 4 0 1 827 580487164 580486338 0.000000e+00 1506
3 TraesCS4B01G125600 chr5A 88.777 695 57 6 2294 2979 466947082 466946400 0.000000e+00 832
4 TraesCS4B01G125600 chr5B 98.890 2163 23 1 817 2979 6981097 6983258 0.000000e+00 3860
5 TraesCS4B01G125600 chr5B 99.395 827 5 0 1 827 6980223 6981049 0.000000e+00 1500
6 TraesCS4B01G125600 chr5B 89.405 689 58 8 2294 2979 431789575 431788899 0.000000e+00 854
7 TraesCS4B01G125600 chr5B 91.045 134 12 0 2294 2427 431786449 431786316 6.560000e-42 182
8 TraesCS4B01G125600 chr7A 97.065 988 20 3 1993 2979 635304549 635305528 0.000000e+00 1655
9 TraesCS4B01G125600 chr7A 95.859 821 28 3 7 827 635303049 635303863 0.000000e+00 1323
10 TraesCS4B01G125600 chr7A 96.273 644 20 3 817 1458 635303911 635304552 0.000000e+00 1053
11 TraesCS4B01G125600 chr3B 99.154 827 7 0 1 827 168140985 168141811 0.000000e+00 1489
12 TraesCS4B01G125600 chr3B 97.343 828 18 2 1 827 740133952 740134776 0.000000e+00 1404
13 TraesCS4B01G125600 chr3B 99.074 324 3 0 2656 2979 168141989 168142312 1.540000e-162 582
14 TraesCS4B01G125600 chr3B 96.899 129 4 0 817 945 168141859 168141987 1.800000e-52 217
15 TraesCS4B01G125600 chr3B 94.624 93 5 0 817 909 740134824 740134916 8.610000e-31 145
16 TraesCS4B01G125600 chrUn 97.222 828 19 2 1 827 280092099 280091275 0.000000e+00 1399
17 TraesCS4B01G125600 chrUn 97.055 815 24 0 870 1684 343821344 343820530 0.000000e+00 1373
18 TraesCS4B01G125600 chrUn 97.208 573 12 2 256 827 325516630 325517199 0.000000e+00 966
19 TraesCS4B01G125600 chrUn 96.552 87 3 0 823 909 280091221 280091135 8.610000e-31 145
20 TraesCS4B01G125600 chrUn 94.624 93 5 0 817 909 325517247 325517339 8.610000e-31 145
21 TraesCS4B01G125600 chrUn 96.552 87 3 0 823 909 325559250 325559164 8.610000e-31 145
22 TraesCS4B01G125600 chr1A 95.493 821 31 3 7 827 570617502 570618316 0.000000e+00 1306
23 TraesCS4B01G125600 chr1A 97.368 190 5 0 817 1006 570618364 570618553 1.030000e-84 324
24 TraesCS4B01G125600 chr1B 98.009 653 13 0 2 654 58019273 58018621 0.000000e+00 1134
25 TraesCS4B01G125600 chr5D 92.495 493 34 2 2489 2979 365302825 365302334 0.000000e+00 702
26 TraesCS4B01G125600 chr2B 94.472 398 20 2 2582 2978 785537807 785538203 1.960000e-171 612
27 TraesCS4B01G125600 chr2A 97.735 309 7 0 2671 2979 654644330 654644022 1.570000e-147 532


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G125600 chr4B 156061820 156064798 2978 False 5502.000000 5502 100.000000 1 2979 1 chr4B.!!$F1 2978
1 TraesCS4B01G125600 chr5A 580484128 580487164 3036 True 2700.500000 3895 99.387000 1 2979 2 chr5A.!!$R2 2978
2 TraesCS4B01G125600 chr5A 466946400 466947082 682 True 832.000000 832 88.777000 2294 2979 1 chr5A.!!$R1 685
3 TraesCS4B01G125600 chr5B 6980223 6983258 3035 False 2680.000000 3860 99.142500 1 2979 2 chr5B.!!$F1 2978
4 TraesCS4B01G125600 chr5B 431786316 431789575 3259 True 518.000000 854 90.225000 2294 2979 2 chr5B.!!$R1 685
5 TraesCS4B01G125600 chr7A 635303049 635305528 2479 False 1343.666667 1655 96.399000 7 2979 3 chr7A.!!$F1 2972
6 TraesCS4B01G125600 chr3B 740133952 740134916 964 False 774.500000 1404 95.983500 1 909 2 chr3B.!!$F2 908
7 TraesCS4B01G125600 chr3B 168140985 168142312 1327 False 762.666667 1489 98.375667 1 2979 3 chr3B.!!$F1 2978
8 TraesCS4B01G125600 chrUn 343820530 343821344 814 True 1373.000000 1373 97.055000 870 1684 1 chrUn.!!$R2 814
9 TraesCS4B01G125600 chrUn 280091135 280092099 964 True 772.000000 1399 96.887000 1 909 2 chrUn.!!$R3 908
10 TraesCS4B01G125600 chrUn 325516630 325517339 709 False 555.500000 966 95.916000 256 909 2 chrUn.!!$F1 653
11 TraesCS4B01G125600 chr1A 570617502 570618553 1051 False 815.000000 1306 96.430500 7 1006 2 chr1A.!!$F1 999
12 TraesCS4B01G125600 chr1B 58018621 58019273 652 True 1134.000000 1134 98.009000 2 654 1 chr1B.!!$R1 652

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
191 192 4.572389 CGCACAGTCCTAATCTAATTGCTT 59.428 41.667 0.0 0.0 0.0 3.91 F
295 296 7.070322 TGTTCCCTACTTGTACTCTTGTAACTT 59.930 37.037 0.0 0.0 0.0 2.66 F
1093 1153 7.174080 GGAGTAAAGAGGCATGGAATAAGATTC 59.826 40.741 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1183 1243 2.039480 TCTCAGCTGCCAACTCTTTCAT 59.961 45.455 9.47 0.00 0.00 2.57 R
1921 1981 4.918588 ACCTTGGTTCATCCGTAGAAAAT 58.081 39.130 0.00 0.00 39.52 1.82 R
2689 2757 2.038269 GTCAAAGGCCGCGGAATCA 61.038 57.895 33.48 3.14 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 4.572389 CGCACAGTCCTAATCTAATTGCTT 59.428 41.667 0.00 0.0 0.00 3.91
239 240 9.743057 CTAATCTAATAGCACAGATGTATAGCC 57.257 37.037 0.00 0.0 31.87 3.93
295 296 7.070322 TGTTCCCTACTTGTACTCTTGTAACTT 59.930 37.037 0.00 0.0 0.00 2.66
1093 1153 7.174080 GGAGTAAAGAGGCATGGAATAAGATTC 59.826 40.741 0.00 0.0 0.00 2.52
1921 1981 7.072562 AGGAGAATAGAGAGCTTTTCCTATCA 58.927 38.462 0.00 0.0 34.00 2.15
2166 2226 8.863872 AATATTTTGGTAGAACTACTTGCTGT 57.136 30.769 11.04 0.0 36.36 4.40
2524 2584 3.710165 TGAGACATCTCCATCATGAAGCT 59.290 43.478 0.00 0.0 42.20 3.74
2689 2757 5.128827 TGGCGAAGGTTGAATAGTTCTCTAT 59.871 40.000 0.00 0.0 38.38 1.98
2795 2866 1.072173 TGCATAGCCCGCATCTACAAT 59.928 47.619 0.00 0.0 33.55 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 6.607004 AGGACTCTAAAAGCTAGCAAACTA 57.393 37.500 18.83 1.73 0.00 2.24
295 296 5.722263 CAATCAATTGTATTGCCTGGTCAA 58.278 37.500 5.13 6.12 33.22 3.18
1093 1153 8.495148 GCCAAACTTTTTGTTTATGTTATCCAG 58.505 33.333 0.00 0.00 46.11 3.86
1177 1237 3.119388 GCTGCCAACTCTTTCATAATGCA 60.119 43.478 0.00 0.00 0.00 3.96
1181 1241 4.005650 CTCAGCTGCCAACTCTTTCATAA 58.994 43.478 9.47 0.00 0.00 1.90
1183 1243 2.039480 TCTCAGCTGCCAACTCTTTCAT 59.961 45.455 9.47 0.00 0.00 2.57
1921 1981 4.918588 ACCTTGGTTCATCCGTAGAAAAT 58.081 39.130 0.00 0.00 39.52 1.82
2166 2226 6.579666 ACATGCTTGCTCTTTCATTTTCTA 57.420 33.333 0.00 0.00 0.00 2.10
2524 2584 8.628630 TGTTGTGTCCTACATAATTTCATTCA 57.371 30.769 0.00 0.00 39.48 2.57
2689 2757 2.038269 GTCAAAGGCCGCGGAATCA 61.038 57.895 33.48 3.14 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.