Multiple sequence alignment - TraesCS4B01G119800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G119800 chr4B 100.000 2627 0 0 1 2627 140208348 140205722 0.000000e+00 4852
1 TraesCS4B01G119800 chr4B 86.211 2618 311 30 1 2616 133862775 133860206 0.000000e+00 2789
2 TraesCS4B01G119800 chr4B 86.357 2045 277 2 584 2627 392064421 392062378 0.000000e+00 2230
3 TraesCS4B01G119800 chr4B 87.331 592 75 0 1 592 392105408 392104817 0.000000e+00 678
4 TraesCS4B01G119800 chr6A 99.353 2627 17 0 1 2627 181519706 181517080 0.000000e+00 4758
5 TraesCS4B01G119800 chr7B 99.315 2627 18 0 1 2627 504487058 504489684 0.000000e+00 4752
6 TraesCS4B01G119800 chr3A 91.998 2012 160 1 614 2624 60235852 60237863 0.000000e+00 2822
7 TraesCS4B01G119800 chr3A 90.662 1842 172 0 786 2627 601617997 601616156 0.000000e+00 2449
8 TraesCS4B01G119800 chr3A 81.818 176 26 1 410 579 676764301 676764126 2.730000e-30 143
9 TraesCS4B01G119800 chr2A 89.359 1889 196 5 739 2624 371718789 371720675 0.000000e+00 2370
10 TraesCS4B01G119800 chr2A 87.989 741 67 13 1 741 371711043 371711761 0.000000e+00 856
11 TraesCS4B01G119800 chr7A 78.496 2646 486 51 1 2624 538978922 538981506 0.000000e+00 1657
12 TraesCS4B01G119800 chr1A 93.103 522 30 3 2095 2616 276614878 276614363 0.000000e+00 760
13 TraesCS4B01G119800 chr2D 95.455 132 5 1 2494 2624 647882602 647882733 2.650000e-50 209
14 TraesCS4B01G119800 chr3D 87.952 166 20 0 410 575 134657126 134656961 2.060000e-46 196


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G119800 chr4B 140205722 140208348 2626 True 4852 4852 100.000 1 2627 1 chr4B.!!$R2 2626
1 TraesCS4B01G119800 chr4B 133860206 133862775 2569 True 2789 2789 86.211 1 2616 1 chr4B.!!$R1 2615
2 TraesCS4B01G119800 chr4B 392062378 392064421 2043 True 2230 2230 86.357 584 2627 1 chr4B.!!$R3 2043
3 TraesCS4B01G119800 chr4B 392104817 392105408 591 True 678 678 87.331 1 592 1 chr4B.!!$R4 591
4 TraesCS4B01G119800 chr6A 181517080 181519706 2626 True 4758 4758 99.353 1 2627 1 chr6A.!!$R1 2626
5 TraesCS4B01G119800 chr7B 504487058 504489684 2626 False 4752 4752 99.315 1 2627 1 chr7B.!!$F1 2626
6 TraesCS4B01G119800 chr3A 60235852 60237863 2011 False 2822 2822 91.998 614 2624 1 chr3A.!!$F1 2010
7 TraesCS4B01G119800 chr3A 601616156 601617997 1841 True 2449 2449 90.662 786 2627 1 chr3A.!!$R1 1841
8 TraesCS4B01G119800 chr2A 371718789 371720675 1886 False 2370 2370 89.359 739 2624 1 chr2A.!!$F2 1885
9 TraesCS4B01G119800 chr2A 371711043 371711761 718 False 856 856 87.989 1 741 1 chr2A.!!$F1 740
10 TraesCS4B01G119800 chr7A 538978922 538981506 2584 False 1657 1657 78.496 1 2624 1 chr7A.!!$F1 2623
11 TraesCS4B01G119800 chr1A 276614363 276614878 515 True 760 760 93.103 2095 2616 1 chr1A.!!$R1 521

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
162 163 2.006415 AAATCCCTCGGCCATCCCA 61.006 57.895 2.24 0.0 0.0 4.37 F
881 903 2.357517 CGAGGTGGTGCAGGTGTC 60.358 66.667 0.00 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1297 1323 1.227853 GGTTGAAGCCCGACACACT 60.228 57.895 0.00 0.00 0.00 3.55 R
1967 1994 1.806542 CCACGAACATTCCAGTTCAGG 59.193 52.381 7.49 4.75 46.32 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 2.006415 AAATCCCTCGGCCATCCCA 61.006 57.895 2.24 0.00 0.00 4.37
880 902 4.626081 GCGAGGTGGTGCAGGTGT 62.626 66.667 0.00 0.00 0.00 4.16
881 903 2.357517 CGAGGTGGTGCAGGTGTC 60.358 66.667 0.00 0.00 0.00 3.67
882 904 2.828868 GAGGTGGTGCAGGTGTCA 59.171 61.111 0.00 0.00 0.00 3.58
1297 1323 0.894184 AAGGAGGAAGACACTCGCGA 60.894 55.000 9.26 9.26 35.82 5.87
1967 1994 4.953667 TGCATGATCAAGACCTGAGTATC 58.046 43.478 0.00 0.00 37.52 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1297 1323 1.227853 GGTTGAAGCCCGACACACT 60.228 57.895 0.00 0.00 0.00 3.55
1967 1994 1.806542 CCACGAACATTCCAGTTCAGG 59.193 52.381 7.49 4.75 46.32 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.