Multiple sequence alignment - TraesCS4B01G110300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G110300 chr4B 100.000 2881 0 0 1 2881 123849264 123846384 0.000000e+00 5321.0
1 TraesCS4B01G110300 chr4B 80.303 198 38 1 2445 2641 515505561 515505364 6.430000e-32 148.0
2 TraesCS4B01G110300 chr5B 99.391 1807 11 0 585 2391 700774297 700776103 0.000000e+00 3277.0
3 TraesCS4B01G110300 chr5B 99.904 1037 1 0 1845 2881 700776114 700777150 0.000000e+00 1910.0
4 TraesCS4B01G110300 chr5B 97.607 585 13 1 1 584 361094144 361094728 0.000000e+00 1002.0
5 TraesCS4B01G110300 chr5B 76.238 202 36 9 844 1039 446589946 446589751 2.360000e-16 97.1
6 TraesCS4B01G110300 chr7D 97.436 585 14 1 1 584 130295164 130294580 0.000000e+00 996.0
7 TraesCS4B01G110300 chr7D 97.265 585 15 1 1 584 434772444 434771860 0.000000e+00 990.0
8 TraesCS4B01G110300 chr7D 76.364 825 144 25 585 1378 542256415 542255611 2.080000e-106 396.0
9 TraesCS4B01G110300 chr6D 97.436 585 14 1 1 584 453973378 453972794 0.000000e+00 996.0
10 TraesCS4B01G110300 chr6D 74.339 756 139 27 597 1331 362257879 362257158 1.320000e-68 270.0
11 TraesCS4B01G110300 chr1D 97.436 585 14 1 1 584 270801012 270800428 0.000000e+00 996.0
12 TraesCS4B01G110300 chr1D 97.265 585 15 1 1 584 423427059 423427643 0.000000e+00 990.0
13 TraesCS4B01G110300 chr1D 77.588 821 134 29 585 1375 421844001 421844801 4.380000e-123 451.0
14 TraesCS4B01G110300 chr1D 88.679 106 9 2 2307 2410 408158558 408158454 3.010000e-25 126.0
15 TraesCS4B01G110300 chr5D 97.265 585 15 1 1 584 247398052 247397468 0.000000e+00 990.0
16 TraesCS4B01G110300 chr5D 91.379 116 7 3 2308 2421 564840182 564840296 3.840000e-34 156.0
17 TraesCS4B01G110300 chr2D 97.265 585 15 1 1 584 322634112 322633528 0.000000e+00 990.0
18 TraesCS4B01G110300 chr2D 82.540 504 69 6 1745 2239 347799879 347799386 2.650000e-115 425.0
19 TraesCS4B01G110300 chr2D 92.523 107 7 1 2309 2414 534738585 534738691 4.970000e-33 152.0
20 TraesCS4B01G110300 chr2D 81.977 172 22 2 1909 2071 518500874 518500703 1.390000e-28 137.0
21 TraesCS4B01G110300 chr2D 85.088 114 13 3 2308 2418 36071811 36071923 2.350000e-21 113.0
22 TraesCS4B01G110300 chr4D 97.089 584 17 0 1 584 37058741 37058158 0.000000e+00 985.0
23 TraesCS4B01G110300 chr4D 97.531 81 2 0 2309 2389 351670145 351670225 3.870000e-29 139.0
24 TraesCS4B01G110300 chrUn 100.000 427 0 0 615 1041 476502463 476502037 0.000000e+00 789.0
25 TraesCS4B01G110300 chr3B 91.080 213 19 0 2639 2851 736407759 736407547 3.630000e-74 289.0
26 TraesCS4B01G110300 chr7B 89.671 213 22 0 2639 2851 690700390 690700602 3.660000e-69 272.0
27 TraesCS4B01G110300 chr3D 75.407 614 118 24 581 1173 359636270 359635669 1.700000e-67 267.0
28 TraesCS4B01G110300 chr3D 94.118 102 3 3 2310 2411 465029511 465029609 4.970000e-33 152.0
29 TraesCS4B01G110300 chr4A 82.558 258 36 8 585 838 662749771 662749519 4.830000e-53 219.0
30 TraesCS4B01G110300 chr4A 80.402 199 38 1 2444 2641 40219334 40219136 1.790000e-32 150.0
31 TraesCS4B01G110300 chr7A 91.150 113 10 0 2309 2421 635669501 635669389 1.380000e-33 154.0
32 TraesCS4B01G110300 chr1B 94.340 53 3 0 2639 2691 41582627 41582679 6.620000e-12 82.4
33 TraesCS4B01G110300 chr1A 84.058 69 9 2 2493 2559 490139208 490139276 6.660000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G110300 chr4B 123846384 123849264 2880 True 5321.0 5321 100.0000 1 2881 1 chr4B.!!$R1 2880
1 TraesCS4B01G110300 chr5B 700774297 700777150 2853 False 2593.5 3277 99.6475 585 2881 2 chr5B.!!$F2 2296
2 TraesCS4B01G110300 chr5B 361094144 361094728 584 False 1002.0 1002 97.6070 1 584 1 chr5B.!!$F1 583
3 TraesCS4B01G110300 chr7D 130294580 130295164 584 True 996.0 996 97.4360 1 584 1 chr7D.!!$R1 583
4 TraesCS4B01G110300 chr7D 434771860 434772444 584 True 990.0 990 97.2650 1 584 1 chr7D.!!$R2 583
5 TraesCS4B01G110300 chr7D 542255611 542256415 804 True 396.0 396 76.3640 585 1378 1 chr7D.!!$R3 793
6 TraesCS4B01G110300 chr6D 453972794 453973378 584 True 996.0 996 97.4360 1 584 1 chr6D.!!$R2 583
7 TraesCS4B01G110300 chr6D 362257158 362257879 721 True 270.0 270 74.3390 597 1331 1 chr6D.!!$R1 734
8 TraesCS4B01G110300 chr1D 270800428 270801012 584 True 996.0 996 97.4360 1 584 1 chr1D.!!$R1 583
9 TraesCS4B01G110300 chr1D 423427059 423427643 584 False 990.0 990 97.2650 1 584 1 chr1D.!!$F2 583
10 TraesCS4B01G110300 chr1D 421844001 421844801 800 False 451.0 451 77.5880 585 1375 1 chr1D.!!$F1 790
11 TraesCS4B01G110300 chr5D 247397468 247398052 584 True 990.0 990 97.2650 1 584 1 chr5D.!!$R1 583
12 TraesCS4B01G110300 chr2D 322633528 322634112 584 True 990.0 990 97.2650 1 584 1 chr2D.!!$R1 583
13 TraesCS4B01G110300 chr4D 37058158 37058741 583 True 985.0 985 97.0890 1 584 1 chr4D.!!$R1 583
14 TraesCS4B01G110300 chr3D 359635669 359636270 601 True 267.0 267 75.4070 581 1173 1 chr3D.!!$R1 592

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
533 536 1.522668 CGAACTTTGATGCCCAGTGA 58.477 50.0 0.0 0.0 0.00 3.41 F
1303 1353 1.041447 GCAGATGGGGCTGAATGCTT 61.041 55.0 0.0 0.0 42.39 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1363 1413 9.241317 CATTGACCAATTATTCTTAGATGCAAC 57.759 33.333 0.00 0.0 0.00 4.17 R
2833 3440 2.954318 GGATAGCACCAATGTCTGCAAT 59.046 45.455 3.45 0.0 35.73 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 215 1.741732 GCTACTCACCAGCAGATGTGG 60.742 57.143 0.00 0.00 41.30 4.17
533 536 1.522668 CGAACTTTGATGCCCAGTGA 58.477 50.000 0.00 0.00 0.00 3.41
1041 1083 3.633986 CCATAAGCAGGTTTGAATCTCCC 59.366 47.826 0.00 0.00 0.00 4.30
1045 1087 1.739067 CAGGTTTGAATCTCCCCGAC 58.261 55.000 0.00 0.00 0.00 4.79
1113 1163 5.073428 TGTGATACTGTGGCCACAAAAATA 58.927 37.500 36.71 25.42 41.33 1.40
1174 1224 8.789762 CAATGATAACAATAGCATGATGGAGAA 58.210 33.333 0.00 0.00 38.14 2.87
1303 1353 1.041447 GCAGATGGGGCTGAATGCTT 61.041 55.000 0.00 0.00 42.39 3.91
1363 1413 1.302383 TGGGCGCAAAGGTACGAATG 61.302 55.000 10.83 0.00 0.00 2.67
1467 1517 6.291796 CGGCAGTTTTTCTTTTCAGATGTTTC 60.292 38.462 0.00 0.00 0.00 2.78
1843 1893 1.796017 GCTCTAGGTAGGGCTCCTTT 58.204 55.000 1.31 0.00 46.23 3.11
2833 3440 6.038161 CGTTCTGATTTTGATGCATTACCCTA 59.962 38.462 0.00 0.00 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 215 2.234908 AGTGACTGCATAGAGGTTGTCC 59.765 50.000 0.00 0.00 0.00 4.02
274 275 0.112025 AGCTGAAGCAAGCCTTTCCT 59.888 50.000 4.90 0.00 44.68 3.36
533 536 6.521162 TCACGGCTATCACACATATTACATT 58.479 36.000 0.00 0.00 0.00 2.71
1113 1163 3.852578 AGTGTCCTAGAAAATCCCCACAT 59.147 43.478 0.00 0.00 0.00 3.21
1174 1224 4.082523 CGACCAGGACCCGCACAT 62.083 66.667 0.00 0.00 0.00 3.21
1303 1353 1.959985 GCTGCTCTATGGAGTGCTCTA 59.040 52.381 8.00 0.00 41.75 2.43
1363 1413 9.241317 CATTGACCAATTATTCTTAGATGCAAC 57.759 33.333 0.00 0.00 0.00 4.17
1467 1517 9.433317 CAGTTTGCCTATGTATACAAATAAACG 57.567 33.333 10.14 9.48 34.78 3.60
2833 3440 2.954318 GGATAGCACCAATGTCTGCAAT 59.046 45.455 3.45 0.00 35.73 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.