Multiple sequence alignment - TraesCS4B01G098700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G098700 chr4B 100.000 2411 0 0 1 2411 104006408 104003998 0.000000e+00 4453.0
1 TraesCS4B01G098700 chr4B 99.088 2412 20 2 1 2411 103891853 103889443 0.000000e+00 4331.0
2 TraesCS4B01G098700 chr4B 98.755 2409 29 1 3 2411 104132313 104129906 0.000000e+00 4281.0
3 TraesCS4B01G098700 chr4B 93.312 957 33 8 554 1481 104341674 104342628 0.000000e+00 1384.0
4 TraesCS4B01G098700 chr4B 96.703 91 3 0 1 91 103892170 103892080 4.150000e-33 152.0
5 TraesCS4B01G098700 chr4D 95.660 1129 22 7 496 1599 70337969 70336843 0.000000e+00 1788.0
6 TraesCS4B01G098700 chr4D 94.705 982 29 7 517 1477 70343655 70342676 0.000000e+00 1504.0
7 TraesCS4B01G098700 chr4D 93.347 977 39 11 554 1507 70365080 70366053 0.000000e+00 1421.0
8 TraesCS4B01G098700 chr4D 88.889 216 12 5 1472 1677 70341945 70341732 3.080000e-64 255.0
9 TraesCS4B01G098700 chr4D 86.792 53 6 1 1901 1953 148235028 148234977 9.310000e-05 58.4
10 TraesCS4B01G098700 chr4A 94.428 1005 34 5 496 1481 522973663 522972662 0.000000e+00 1526.0
11 TraesCS4B01G098700 chr4A 93.750 944 36 8 558 1481 524178548 524179488 0.000000e+00 1395.0
12 TraesCS4B01G098700 chr4A 89.130 276 15 5 1401 1662 522972496 522972222 1.790000e-86 329.0
13 TraesCS4B01G098700 chr4A 100.000 29 0 0 1901 1929 734891193 734891221 1.000000e-03 54.7
14 TraesCS4B01G098700 chr6B 98.125 480 9 0 1 480 68183540 68184019 0.000000e+00 837.0
15 TraesCS4B01G098700 chr6B 95.402 87 4 0 1800 1886 12535598 12535684 3.230000e-29 139.0
16 TraesCS4B01G098700 chr7A 97.500 480 11 1 1 480 699928537 699929015 0.000000e+00 819.0
17 TraesCS4B01G098700 chr7A 88.102 353 34 7 134 480 362149835 362150185 1.720000e-111 412.0
18 TraesCS4B01G098700 chr7A 92.045 88 7 0 1802 1889 679366419 679366332 9.050000e-25 124.0
19 TraesCS4B01G098700 chr7A 87.931 58 6 1 22 78 361406666 361406723 1.550000e-07 67.6
20 TraesCS4B01G098700 chr1A 97.500 480 11 1 1 480 254661157 254660679 0.000000e+00 819.0
21 TraesCS4B01G098700 chr1A 93.023 86 6 0 1801 1886 561307124 561307039 2.520000e-25 126.0
22 TraesCS4B01G098700 chr1A 100.000 37 0 0 1 37 379191435 379191471 4.300000e-08 69.4
23 TraesCS4B01G098700 chr7B 97.292 480 12 1 1 480 639526590 639526112 0.000000e+00 813.0
24 TraesCS4B01G098700 chr7B 93.023 86 6 0 1801 1886 617549425 617549340 2.520000e-25 126.0
25 TraesCS4B01G098700 chr5A 87.413 572 62 7 761 1329 365656830 365656266 0.000000e+00 649.0
26 TraesCS4B01G098700 chr7D 90.341 352 26 7 134 480 317662898 317662550 2.830000e-124 455.0
27 TraesCS4B01G098700 chr3A 88.746 311 24 10 177 480 47812056 47812362 1.050000e-98 370.0
28 TraesCS4B01G098700 chr3D 94.118 85 5 0 1800 1884 406173572 406173656 1.950000e-26 130.0
29 TraesCS4B01G098700 chr6D 93.182 88 5 1 1802 1889 2753485 2753399 7.000000e-26 128.0
30 TraesCS4B01G098700 chr1D 90.426 94 8 1 1795 1887 255832473 255832380 3.260000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G098700 chr4B 104003998 104006408 2410 True 4453.000000 4453 100.000000 1 2411 1 chr4B.!!$R1 2410
1 TraesCS4B01G098700 chr4B 104129906 104132313 2407 True 4281.000000 4281 98.755000 3 2411 1 chr4B.!!$R2 2408
2 TraesCS4B01G098700 chr4B 103889443 103892170 2727 True 2241.500000 4331 97.895500 1 2411 2 chr4B.!!$R3 2410
3 TraesCS4B01G098700 chr4B 104341674 104342628 954 False 1384.000000 1384 93.312000 554 1481 1 chr4B.!!$F1 927
4 TraesCS4B01G098700 chr4D 70365080 70366053 973 False 1421.000000 1421 93.347000 554 1507 1 chr4D.!!$F1 953
5 TraesCS4B01G098700 chr4D 70336843 70343655 6812 True 1182.333333 1788 93.084667 496 1677 3 chr4D.!!$R2 1181
6 TraesCS4B01G098700 chr4A 524178548 524179488 940 False 1395.000000 1395 93.750000 558 1481 1 chr4A.!!$F1 923
7 TraesCS4B01G098700 chr4A 522972222 522973663 1441 True 927.500000 1526 91.779000 496 1662 2 chr4A.!!$R1 1166
8 TraesCS4B01G098700 chr5A 365656266 365656830 564 True 649.000000 649 87.413000 761 1329 1 chr5A.!!$R1 568

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
309 627 2.561478 ACGGTAACACTCATTTGCCT 57.439 45.0 0.0 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1617 2968 2.610727 CGTCCTCCTCCAACTGTTCTTC 60.611 54.545 0.0 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
158 476 5.779241 ATCTGGTATCTCCTTTTTGACCA 57.221 39.130 0.00 0.00 35.69 4.02
220 538 4.286910 TCAAATGCAACGTTGTAGCTTTC 58.713 39.130 27.78 11.03 0.00 2.62
309 627 2.561478 ACGGTAACACTCATTTGCCT 57.439 45.000 0.00 0.00 0.00 4.75
366 684 9.108284 CATGAACCAAACAAAGGAAAATAACTT 57.892 29.630 0.00 0.00 0.00 2.66
931 1280 2.892640 CGACATGAAGGAGGCGGA 59.107 61.111 0.00 0.00 0.00 5.54
1819 3193 6.777213 ACATGTACTCCCTCTGTAAACTAG 57.223 41.667 0.00 0.00 0.00 2.57
1833 3207 8.906636 TCTGTAAACTAGTATAAGAGCGTTTG 57.093 34.615 0.00 0.00 0.00 2.93
2114 3568 1.553417 GGATATAGAGAGGCCTGGGCA 60.553 57.143 23.25 0.74 44.11 5.36
2133 3587 2.181021 GTCCGCCACGTCGAATCT 59.819 61.111 0.00 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 538 4.035091 TCCACACGAAACAGAGAAAATGTG 59.965 41.667 0.00 0.0 36.74 3.21
309 627 8.280258 AGGAATGGGAATTGTTCTATGAGATA 57.720 34.615 0.00 0.0 0.00 1.98
366 684 5.512942 TTATCAGTGGGAATTCAACAGGA 57.487 39.130 7.93 7.4 0.00 3.86
1617 2968 2.610727 CGTCCTCCTCCAACTGTTCTTC 60.611 54.545 0.00 0.0 0.00 2.87
1710 3084 4.877378 ATTGAACATTTGGACTGCACAT 57.123 36.364 0.00 0.0 0.00 3.21
1819 3193 6.505272 AGTAGTGATCCAAACGCTCTTATAC 58.495 40.000 0.00 0.0 0.00 1.47
1864 3238 9.028284 CCATATACTCCCTCCGTAAACTAATAA 57.972 37.037 0.00 0.0 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.