Multiple sequence alignment - TraesCS4B01G083500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G083500 chr4B 100.000 2322 0 0 1 2322 82274869 82272548 0.000000e+00 4289
1 TraesCS4B01G083500 chr5B 97.358 2347 35 2 1 2322 351452640 351450296 0.000000e+00 3965
2 TraesCS4B01G083500 chr5B 95.671 901 14 1 1 876 646632605 646633505 0.000000e+00 1424
3 TraesCS4B01G083500 chr5B 90.819 403 11 10 1 377 177128349 177128751 1.230000e-142 516
4 TraesCS4B01G083500 chr3B 97.188 2347 39 2 1 2322 28344903 28347247 0.000000e+00 3943
5 TraesCS4B01G083500 chr3B 96.662 2337 50 5 1 2312 542641780 542639447 0.000000e+00 3858
6 TraesCS4B01G083500 chr3B 96.506 2347 53 5 1 2322 81550496 81548154 0.000000e+00 3853
7 TraesCS4B01G083500 chr3B 95.654 2347 73 9 1 2321 14264690 14267033 0.000000e+00 3742
8 TraesCS4B01G083500 chr3B 94.423 789 18 2 1 764 733251458 733250671 0.000000e+00 1190
9 TraesCS4B01G083500 chr7B 96.287 2343 59 4 6 2322 664294573 664296913 0.000000e+00 3819
10 TraesCS4B01G083500 chr7B 95.894 2338 61 6 1 2312 678100701 678103029 0.000000e+00 3753
11 TraesCS4B01G083500 chr7B 95.771 2341 64 6 1 2315 134328703 134326372 0.000000e+00 3742
12 TraesCS4B01G083500 chr7B 96.045 1694 40 3 1 1667 415417043 415418736 0.000000e+00 2732
13 TraesCS4B01G083500 chr7B 96.660 1557 24 3 1 1532 562400492 562398939 0.000000e+00 2562
14 TraesCS4B01G083500 chr1B 96.067 2339 56 7 1 2312 615476917 615479246 0.000000e+00 3777
15 TraesCS4B01G083500 chr1B 95.937 2338 60 14 1 2312 618191046 618188718 0.000000e+00 3759
16 TraesCS4B01G083500 chr1B 95.212 2339 70 18 1 2312 122762300 122764623 0.000000e+00 3661


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G083500 chr4B 82272548 82274869 2321 True 4289 4289 100.000 1 2322 1 chr4B.!!$R1 2321
1 TraesCS4B01G083500 chr5B 351450296 351452640 2344 True 3965 3965 97.358 1 2322 1 chr5B.!!$R1 2321
2 TraesCS4B01G083500 chr5B 646632605 646633505 900 False 1424 1424 95.671 1 876 1 chr5B.!!$F2 875
3 TraesCS4B01G083500 chr3B 28344903 28347247 2344 False 3943 3943 97.188 1 2322 1 chr3B.!!$F2 2321
4 TraesCS4B01G083500 chr3B 542639447 542641780 2333 True 3858 3858 96.662 1 2312 1 chr3B.!!$R2 2311
5 TraesCS4B01G083500 chr3B 81548154 81550496 2342 True 3853 3853 96.506 1 2322 1 chr3B.!!$R1 2321
6 TraesCS4B01G083500 chr3B 14264690 14267033 2343 False 3742 3742 95.654 1 2321 1 chr3B.!!$F1 2320
7 TraesCS4B01G083500 chr3B 733250671 733251458 787 True 1190 1190 94.423 1 764 1 chr3B.!!$R3 763
8 TraesCS4B01G083500 chr7B 664294573 664296913 2340 False 3819 3819 96.287 6 2322 1 chr7B.!!$F2 2316
9 TraesCS4B01G083500 chr7B 678100701 678103029 2328 False 3753 3753 95.894 1 2312 1 chr7B.!!$F3 2311
10 TraesCS4B01G083500 chr7B 134326372 134328703 2331 True 3742 3742 95.771 1 2315 1 chr7B.!!$R1 2314
11 TraesCS4B01G083500 chr7B 415417043 415418736 1693 False 2732 2732 96.045 1 1667 1 chr7B.!!$F1 1666
12 TraesCS4B01G083500 chr7B 562398939 562400492 1553 True 2562 2562 96.660 1 1532 1 chr7B.!!$R2 1531
13 TraesCS4B01G083500 chr1B 615476917 615479246 2329 False 3777 3777 96.067 1 2312 1 chr1B.!!$F2 2311
14 TraesCS4B01G083500 chr1B 618188718 618191046 2328 True 3759 3759 95.937 1 2312 1 chr1B.!!$R1 2311
15 TraesCS4B01G083500 chr1B 122762300 122764623 2323 False 3661 3661 95.212 1 2312 1 chr1B.!!$F1 2311

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
41 42 5.365314 AGAATTGGTGTTGGTAATGTGGTTT 59.635 36.0 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1424 1456 1.821216 CCACTCCACCGCATAAAAGT 58.179 50.0 0.0 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 5.365314 AGAATTGGTGTTGGTAATGTGGTTT 59.635 36.000 0.00 0.00 0.00 3.27
1424 1456 1.141858 TGTGCGTTGCCCCATGATATA 59.858 47.619 0.00 0.00 0.00 0.86
1494 1527 1.228033 AGTACAACAACGCACCCCC 60.228 57.895 0.00 0.00 0.00 5.40
1591 1624 7.961351 ACCACTGAAAAATGAAATTGATACCA 58.039 30.769 0.00 0.00 36.10 3.25
1674 1707 2.806945 CACCATCTTATGTGGGTGGT 57.193 50.000 0.00 0.00 45.48 4.16
1864 1897 2.927871 GCTGATGGTGCATTCAACAACC 60.928 50.000 0.00 0.00 44.13 3.77
2072 2105 2.818432 GGTAGAGAAACAGACGGTCTCA 59.182 50.000 7.89 0.00 40.26 3.27
2265 2299 1.624487 CGTGCACGTGCTCAGTATAA 58.376 50.000 37.59 15.28 42.66 0.98
2312 2346 2.061773 CATCTTCGAGTCAAGCACGTT 58.938 47.619 0.00 0.00 33.02 3.99
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 289 9.982651 ACACGCACAATTTATATACTTCTCTAT 57.017 29.630 0.00 0.00 0.00 1.98
563 590 1.687297 CCTTCCCGGTAAGAGCCCTC 61.687 65.000 8.60 0.00 0.00 4.30
1424 1456 1.821216 CCACTCCACCGCATAAAAGT 58.179 50.000 0.00 0.00 0.00 2.66
1494 1527 2.233922 ACTTGTCTCAACATACTCCGGG 59.766 50.000 0.00 0.00 34.73 5.73
1591 1624 5.812642 CGTCCTACAAAGCATGAGAAGTATT 59.187 40.000 0.00 0.00 0.00 1.89
1673 1706 2.676839 CTCTGAGCATTCCACATGTCAC 59.323 50.000 0.00 0.00 0.00 3.67
1674 1707 2.355412 CCTCTGAGCATTCCACATGTCA 60.355 50.000 0.00 0.00 0.00 3.58
1864 1897 3.008485 GCTCCAATGGTCTCCCTAATAGG 59.992 52.174 0.00 0.00 34.30 2.57
2072 2105 7.519927 CCTCTAACCTGTAGAGTACTCCTAAT 58.480 42.308 19.38 3.39 39.42 1.73
2265 2299 4.082125 AGCGGAAGAAAGAACATCCATTT 58.918 39.130 0.00 0.00 32.08 2.32
2302 2336 1.497991 CGGAAGAAGAACGTGCTTGA 58.502 50.000 15.19 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.