Multiple sequence alignment - TraesCS4B01G069100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G069100 chr4B 100.000 2182 0 0 170 2351 62869998 62867817 0.000000e+00 4030.0
1 TraesCS4B01G069100 chr4B 95.107 2187 63 17 170 2351 61535671 61537818 0.000000e+00 3406.0
2 TraesCS4B01G069100 chr4B 93.909 2200 76 18 170 2351 61522585 61524744 0.000000e+00 3267.0
3 TraesCS4B01G069100 chr4B 93.608 1940 73 30 450 2351 61325048 61323122 0.000000e+00 2848.0
4 TraesCS4B01G069100 chr4B 92.962 952 36 7 231 1181 62057043 62056122 0.000000e+00 1358.0
5 TraesCS4B01G069100 chr4B 84.229 1395 105 46 170 1548 139941006 139939711 0.000000e+00 1251.0
6 TraesCS4B01G069100 chr4B 95.186 644 21 3 1716 2351 140435816 140435175 0.000000e+00 1009.0
7 TraesCS4B01G069100 chr4B 94.819 637 30 2 1716 2351 61494886 61494252 0.000000e+00 990.0
8 TraesCS4B01G069100 chr4B 94.704 642 24 3 1718 2351 140232873 140232234 0.000000e+00 989.0
9 TraesCS4B01G069100 chr4B 82.906 1170 111 52 396 1548 140437028 140435931 0.000000e+00 970.0
10 TraesCS4B01G069100 chr4B 89.373 781 38 19 170 940 61888913 61889658 0.000000e+00 941.0
11 TraesCS4B01G069100 chr4B 93.407 637 25 6 1716 2351 62049557 62048937 0.000000e+00 928.0
12 TraesCS4B01G069100 chr4B 89.973 738 29 17 173 899 62434207 62433504 0.000000e+00 911.0
13 TraesCS4B01G069100 chr4B 94.737 570 28 1 1716 2285 139939597 139939030 0.000000e+00 885.0
14 TraesCS4B01G069100 chr4B 87.189 562 50 14 170 729 62040280 62039739 9.230000e-174 619.0
15 TraesCS4B01G069100 chr4B 84.142 618 57 22 936 1548 61495561 61494980 5.670000e-156 560.0
16 TraesCS4B01G069100 chr4B 100.000 35 0 0 1 35 62870167 62870133 5.420000e-07 65.8
17 TraesCS4B01G069100 chr4A 88.765 1709 105 39 170 1840 556780804 556782463 0.000000e+00 2012.0
18 TraesCS4B01G069100 chr4A 94.137 307 17 1 1342 1648 556804441 556804746 1.270000e-127 466.0
19 TraesCS4B01G069100 chr1D 87.993 1674 139 26 186 1840 55609490 55611120 0.000000e+00 1921.0
20 TraesCS4B01G069100 chr1D 91.667 300 16 5 1541 1840 55545820 55546110 7.820000e-110 407.0
21 TraesCS4B01G069100 chr1D 81.526 498 71 16 185 671 55545317 55545804 7.880000e-105 390.0
22 TraesCS4B01G069100 chr4D 89.171 1459 94 20 170 1624 43151912 43150514 0.000000e+00 1760.0
23 TraesCS4B01G069100 chr4D 84.228 1471 132 53 170 1624 43077613 43076227 0.000000e+00 1339.0
24 TraesCS4B01G069100 chr4D 91.944 720 28 9 1652 2351 43076051 43075342 0.000000e+00 981.0
25 TraesCS4B01G069100 chr2A 90.110 91 7 2 1846 1936 322406129 322406041 1.480000e-22 117.0
26 TraesCS4B01G069100 chr2B 86.842 76 6 2 1645 1719 418951216 418951288 5.390000e-12 82.4
27 TraesCS4B01G069100 chr5A 80.208 96 7 6 1640 1726 364712718 364712626 7.020000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G069100 chr4B 62867817 62870167 2350 True 2047.9 4030 100.0000 1 2351 2 chr4B.!!$R8 2350
1 TraesCS4B01G069100 chr4B 61535671 61537818 2147 False 3406.0 3406 95.1070 170 2351 1 chr4B.!!$F2 2181
2 TraesCS4B01G069100 chr4B 61522585 61524744 2159 False 3267.0 3267 93.9090 170 2351 1 chr4B.!!$F1 2181
3 TraesCS4B01G069100 chr4B 61323122 61325048 1926 True 2848.0 2848 93.6080 450 2351 1 chr4B.!!$R1 1901
4 TraesCS4B01G069100 chr4B 62056122 62057043 921 True 1358.0 1358 92.9620 231 1181 1 chr4B.!!$R4 950
5 TraesCS4B01G069100 chr4B 139939030 139941006 1976 True 1068.0 1251 89.4830 170 2285 2 chr4B.!!$R9 2115
6 TraesCS4B01G069100 chr4B 140435175 140437028 1853 True 989.5 1009 89.0460 396 2351 2 chr4B.!!$R10 1955
7 TraesCS4B01G069100 chr4B 140232234 140232873 639 True 989.0 989 94.7040 1718 2351 1 chr4B.!!$R6 633
8 TraesCS4B01G069100 chr4B 61888913 61889658 745 False 941.0 941 89.3730 170 940 1 chr4B.!!$F3 770
9 TraesCS4B01G069100 chr4B 62048937 62049557 620 True 928.0 928 93.4070 1716 2351 1 chr4B.!!$R3 635
10 TraesCS4B01G069100 chr4B 62433504 62434207 703 True 911.0 911 89.9730 173 899 1 chr4B.!!$R5 726
11 TraesCS4B01G069100 chr4B 61494252 61495561 1309 True 775.0 990 89.4805 936 2351 2 chr4B.!!$R7 1415
12 TraesCS4B01G069100 chr4B 62039739 62040280 541 True 619.0 619 87.1890 170 729 1 chr4B.!!$R2 559
13 TraesCS4B01G069100 chr4A 556780804 556782463 1659 False 2012.0 2012 88.7650 170 1840 1 chr4A.!!$F1 1670
14 TraesCS4B01G069100 chr1D 55609490 55611120 1630 False 1921.0 1921 87.9930 186 1840 1 chr1D.!!$F1 1654
15 TraesCS4B01G069100 chr1D 55545317 55546110 793 False 398.5 407 86.5965 185 1840 2 chr1D.!!$F2 1655
16 TraesCS4B01G069100 chr4D 43150514 43151912 1398 True 1760.0 1760 89.1710 170 1624 1 chr4D.!!$R1 1454
17 TraesCS4B01G069100 chr4D 43075342 43077613 2271 True 1160.0 1339 88.0860 170 2351 2 chr4D.!!$R2 2181

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
326 348 0.982852 TCCAGGTCCAGCCACCATAG 60.983 60.0 0.0 0.0 39.16 2.23 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2024 2377 1.757682 AGAGTCGAGCGAAGGATCTT 58.242 50.0 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 9.889128 AAAATGAAGGAAACAAAAAGATGAAGA 57.111 25.926 0.00 0.0 0.00 2.87
30 31 9.889128 AAATGAAGGAAACAAAAAGATGAAGAA 57.111 25.926 0.00 0.0 0.00 2.52
33 34 9.150348 TGAAGGAAACAAAAAGATGAAGAAAAC 57.850 29.630 0.00 0.0 0.00 2.43
34 35 9.371136 GAAGGAAACAAAAAGATGAAGAAAACT 57.629 29.630 0.00 0.0 0.00 2.66
226 242 3.716601 CACAAAACCCGCTGAAGAAATT 58.283 40.909 0.00 0.0 0.00 1.82
326 348 0.982852 TCCAGGTCCAGCCACCATAG 60.983 60.000 0.00 0.0 39.16 2.23
556 582 8.860128 GCATATGATGAACATTTTATGATGCAG 58.140 33.333 6.97 0.0 40.37 4.41
692 816 6.937886 AAGAAAAGAAAAAGCGAACGAAAA 57.062 29.167 0.00 0.0 0.00 2.29
1465 1619 4.835615 TGCAGAGTCCTTTCTTTCTAGACT 59.164 41.667 0.00 0.0 40.40 3.24
1558 1717 0.603975 ACAAGAAGTTGAGGAGGCGC 60.604 55.000 0.00 0.0 37.10 6.53
1658 1846 7.176340 TCAGTTAGTACTCCCTCTGTAAACTTC 59.824 40.741 0.00 0.0 30.26 3.01
1840 2159 7.486407 AATTTCCCTATCTTGCATTGTTTCT 57.514 32.000 0.00 0.0 0.00 2.52
1843 2162 5.684704 TCCCTATCTTGCATTGTTTCTAGG 58.315 41.667 0.00 0.0 0.00 3.02
1882 2217 4.141937 CGAGATCTTATGGGTTTCACCTCA 60.142 45.833 0.00 0.0 38.64 3.86
1941 2294 6.372659 TCCTTAGCTTTATGTTTTCTGCTCTG 59.627 38.462 0.00 0.0 32.72 3.35
1959 2312 2.639327 GGTCTTTGCGCCTTGGCAT 61.639 57.895 4.18 0.0 43.52 4.40
2024 2377 2.479837 CTTGTCCGCTCTGTAAACACA 58.520 47.619 0.00 0.0 0.00 3.72
2114 2467 2.303311 GCCAGGAGTTCTTCTACCTTGT 59.697 50.000 0.00 0.0 0.00 3.16
2217 2578 3.309954 GCCCAGAACTATTTCGATGTGTC 59.690 47.826 0.00 0.0 36.78 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 9.371136 AGTTTTCTTCATCTTTTTGTTTCCTTC 57.629 29.630 0.00 0.00 0.00 3.46
326 348 1.618640 GCTCGCTGGTTCGTTCACTC 61.619 60.000 0.00 0.00 0.00 3.51
573 602 9.585099 CCGTATATTAACAAAACCTACACTGTA 57.415 33.333 0.00 0.00 0.00 2.74
574 603 8.096414 ACCGTATATTAACAAAACCTACACTGT 58.904 33.333 0.00 0.00 0.00 3.55
575 604 8.483307 ACCGTATATTAACAAAACCTACACTG 57.517 34.615 0.00 0.00 0.00 3.66
1583 1742 2.045926 GCACATCCGGCCTCTTGT 60.046 61.111 0.00 0.00 0.00 3.16
1814 2133 9.034800 AGAAACAATGCAAGATAGGGAAATTTA 57.965 29.630 0.00 0.00 0.00 1.40
1815 2134 7.910584 AGAAACAATGCAAGATAGGGAAATTT 58.089 30.769 0.00 0.00 0.00 1.82
1882 2217 2.316108 CAAACAAGTTGGGGTAGGCTT 58.684 47.619 7.96 0.00 33.18 4.35
1941 2294 2.639327 ATGCCAAGGCGCAAAGACC 61.639 57.895 10.83 0.00 43.24 3.85
2024 2377 1.757682 AGAGTCGAGCGAAGGATCTT 58.242 50.000 0.00 0.00 0.00 2.40
2114 2467 7.453393 ACTTGGAAGATTCAACTAGATGACAA 58.547 34.615 1.57 2.35 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.