Multiple sequence alignment - TraesCS4B01G036400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G036400 chr4B 100.000 2690 0 0 1 2690 26282650 26279961 0.000000e+00 4968.0
1 TraesCS4B01G036400 chr4B 98.401 2690 28 1 1 2690 26159406 26156732 0.000000e+00 4715.0
2 TraesCS4B01G036400 chr4B 99.241 1975 15 0 716 2690 26200748 26198774 0.000000e+00 3565.0
3 TraesCS4B01G036400 chr4B 98.734 1975 25 0 716 2690 26072669 26070695 0.000000e+00 3509.0
4 TraesCS4B01G036400 chr4B 98.076 1975 20 2 716 2690 26242447 26240491 0.000000e+00 3421.0
5 TraesCS4B01G036400 chr4B 98.741 1509 19 0 1182 2690 25983039 25981531 0.000000e+00 2682.0
6 TraesCS4B01G036400 chr4B 98.707 1315 17 0 1 1315 26109699 26108385 0.000000e+00 2335.0
7 TraesCS4B01G036400 chr4B 98.186 1323 22 2 1370 2690 26020717 26019395 0.000000e+00 2309.0
8 TraesCS4B01G036400 chr4B 97.770 852 17 1 1 852 25983884 25983035 0.000000e+00 1467.0
9 TraesCS4B01G036400 chr4B 98.006 702 13 1 1 702 26021409 26020709 0.000000e+00 1218.0
10 TraesCS4B01G036400 chr4B 96.482 739 20 2 946 1684 26351941 26351209 0.000000e+00 1216.0
11 TraesCS4B01G036400 chr4B 98.611 648 9 0 1 648 26073322 26072675 0.000000e+00 1147.0
12 TraesCS4B01G036400 chr4B 97.994 648 13 0 1 648 26201401 26200754 0.000000e+00 1125.0
13 TraesCS4B01G036400 chr4B 96.316 190 7 0 459 648 26242642 26242453 2.010000e-81 313.0
14 TraesCS4B01G036400 chr4B 97.872 141 1 2 1683 1821 26017288 26017148 2.680000e-60 243.0
15 TraesCS4B01G036400 chr4B 92.969 128 7 2 766 893 26352197 26352072 4.570000e-43 185.0
16 TraesCS4B01G036400 chrUn 99.074 1080 6 4 745 1821 382348023 382349101 0.000000e+00 1936.0
17 TraesCS4B01G036400 chrUn 75.730 445 87 15 994 1437 8090669 8091093 1.260000e-48 204.0
18 TraesCS4B01G036400 chr4A 90.157 508 33 10 952 1457 585054523 585055015 0.000000e+00 645.0
19 TraesCS4B01G036400 chr4A 86.429 140 14 3 599 733 585054086 585054225 6.000000e-32 148.0
20 TraesCS4B01G036400 chr4D 91.587 416 33 2 2276 2690 15530421 15530007 8.350000e-160 573.0
21 TraesCS4B01G036400 chr4D 92.891 211 8 3 1698 1907 15533637 15533433 1.570000e-77 300.0
22 TraesCS4B01G036400 chr4D 92.571 175 9 2 1968 2138 15533440 15533266 5.750000e-62 248.0
23 TraesCS4B01G036400 chr4D 91.358 162 11 2 599 757 15534104 15533943 4.510000e-53 219.0
24 TraesCS4B01G036400 chr4D 87.135 171 15 6 1525 1689 15533923 15533754 1.270000e-43 187.0
25 TraesCS4B01G036400 chr4D 89.024 82 9 0 2133 2214 15533088 15533007 4.740000e-18 102.0
26 TraesCS4B01G036400 chr4D 95.349 43 2 0 2217 2259 15530463 15530421 4.810000e-08 69.4
27 TraesCS4B01G036400 chr5B 90.524 401 37 1 1 401 225509319 225509718 1.830000e-146 529.0
28 TraesCS4B01G036400 chr5B 84.536 194 23 3 401 590 225510004 225510194 4.570000e-43 185.0
29 TraesCS4B01G036400 chr7D 93.114 334 23 0 68 401 91581814 91581481 8.650000e-135 490.0
30 TraesCS4B01G036400 chr7D 91.765 170 13 1 1 170 91581984 91581816 4.480000e-58 235.0
31 TraesCS4B01G036400 chr7D 85.000 200 23 5 401 596 91581174 91580978 2.110000e-46 196.0
32 TraesCS4B01G036400 chr7B 78.832 274 37 11 2416 2682 355704213 355704472 5.960000e-37 165.0
33 TraesCS4B01G036400 chr3B 83.333 180 23 5 2507 2681 591673857 591674034 2.770000e-35 159.0
34 TraesCS4B01G036400 chr1D 77.936 281 41 12 2416 2687 235168802 235168534 3.590000e-34 156.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G036400 chr4B 26279961 26282650 2689 True 4968.000000 4968 100.000000 1 2690 1 chr4B.!!$R3 2689
1 TraesCS4B01G036400 chr4B 26156732 26159406 2674 True 4715.000000 4715 98.401000 1 2690 1 chr4B.!!$R2 2689
2 TraesCS4B01G036400 chr4B 26198774 26201401 2627 True 2345.000000 3565 98.617500 1 2690 2 chr4B.!!$R7 2689
3 TraesCS4B01G036400 chr4B 26108385 26109699 1314 True 2335.000000 2335 98.707000 1 1315 1 chr4B.!!$R1 1314
4 TraesCS4B01G036400 chr4B 26070695 26073322 2627 True 2328.000000 3509 98.672500 1 2690 2 chr4B.!!$R6 2689
5 TraesCS4B01G036400 chr4B 25981531 25983884 2353 True 2074.500000 2682 98.255500 1 2690 2 chr4B.!!$R4 2689
6 TraesCS4B01G036400 chr4B 26240491 26242642 2151 True 1867.000000 3421 97.196000 459 2690 2 chr4B.!!$R8 2231
7 TraesCS4B01G036400 chr4B 26017148 26021409 4261 True 1256.666667 2309 98.021333 1 2690 3 chr4B.!!$R5 2689
8 TraesCS4B01G036400 chr4B 26351209 26352197 988 True 700.500000 1216 94.725500 766 1684 2 chr4B.!!$R9 918
9 TraesCS4B01G036400 chrUn 382348023 382349101 1078 False 1936.000000 1936 99.074000 745 1821 1 chrUn.!!$F2 1076
10 TraesCS4B01G036400 chr4A 585054086 585055015 929 False 396.500000 645 88.293000 599 1457 2 chr4A.!!$F1 858
11 TraesCS4B01G036400 chr4D 15530007 15534104 4097 True 242.628571 573 91.416429 599 2690 7 chr4D.!!$R1 2091
12 TraesCS4B01G036400 chr5B 225509319 225510194 875 False 357.000000 529 87.530000 1 590 2 chr5B.!!$F1 589
13 TraesCS4B01G036400 chr7D 91580978 91581984 1006 True 307.000000 490 89.959667 1 596 3 chr7D.!!$R1 595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 968 0.955428 TGAATGGCCGAGAACACTGC 60.955 55.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2469 5885 0.37337 CGCCATGTTACCATCGTGTG 59.627 55.0 0.0 0.0 0.0 3.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
552 968 0.955428 TGAATGGCCGAGAACACTGC 60.955 55.000 0.00 0.00 0.00 4.40
1523 2098 1.272147 GGAAGTGTCAGGGCTGGAAAT 60.272 52.381 0.00 0.00 0.00 2.17
1855 2543 4.976116 GTGGCCGTTAATTGCAATCTTATC 59.024 41.667 13.38 1.94 0.00 1.75
1867 2555 6.377327 TGCAATCTTATCGATTTTCCTTCC 57.623 37.500 1.71 0.00 40.33 3.46
2199 3074 2.191641 GCATCTCACAGGCCTCCC 59.808 66.667 0.00 0.00 0.00 4.30
2469 5885 2.159128 GGGTCCTAAGTTAGGCGTCTTC 60.159 54.545 22.30 8.63 45.82 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 329 1.052124 CCTATAGGTCCCGGGCAACA 61.052 60.000 18.49 0.49 39.74 3.33
508 921 5.096849 TCGTTATTTTGGATTTTTAGCCGC 58.903 37.500 0.00 0.00 0.00 6.53
552 968 0.979665 TTTCAGCCCTCTCAGGTCAG 59.020 55.000 0.00 0.00 31.93 3.51
609 1025 2.187946 CGCCCGGCAAGAGATCTT 59.812 61.111 10.77 0.00 36.45 2.40
636 1054 2.678336 GCTGAGTGGCTAATGTTGTACC 59.322 50.000 0.00 0.00 0.00 3.34
864 1351 1.820519 CCATGAAGTGAACCATGTGGG 59.179 52.381 3.77 0.00 38.69 4.61
1523 2098 0.687920 TGTTGGTGCTTGGTCCGATA 59.312 50.000 0.00 0.00 0.00 2.92
1855 2543 8.220755 TCCATATTACAAAGGAAGGAAAATCG 57.779 34.615 0.00 0.00 0.00 3.34
2184 3059 2.039624 ACGGGAGGCCTGTGAGAT 59.960 61.111 12.00 0.00 42.23 2.75
2469 5885 0.373370 CGCCATGTTACCATCGTGTG 59.627 55.000 0.00 0.00 0.00 3.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.