Multiple sequence alignment - TraesCS4B01G036300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G036300 chr4B 100.000 2718 0 0 1 2718 26243164 26240447 0.000000e+00 5020.0
1 TraesCS4B01G036300 chr4B 98.419 2214 17 2 523 2718 26200943 26198730 0.000000e+00 3879.0
2 TraesCS4B01G036300 chr4B 98.193 2214 22 2 523 2718 26072864 26070651 0.000000e+00 3851.0
3 TraesCS4B01G036300 chr4B 99.251 2004 12 1 718 2718 26158691 26156688 0.000000e+00 3615.0
4 TraesCS4B01G036300 chr4B 98.036 1986 21 2 718 2685 26281935 26279950 0.000000e+00 3435.0
5 TraesCS4B01G036300 chr4B 97.746 1553 17 2 1184 2718 25983039 25981487 0.000000e+00 2658.0
6 TraesCS4B01G036300 chr4B 97.001 1367 21 4 1372 2718 26020717 26019351 0.000000e+00 2279.0
7 TraesCS4B01G036300 chr4B 94.317 739 21 3 948 1671 26351941 26351209 0.000000e+00 1112.0
8 TraesCS4B01G036300 chr4B 99.500 600 3 0 718 1317 26108984 26108385 0.000000e+00 1092.0
9 TraesCS4B01G036300 chr4B 99.049 526 5 0 1 526 26023467 26022942 0.000000e+00 944.0
10 TraesCS4B01G036300 chr4B 99.049 526 5 0 1 526 26284707 26284182 0.000000e+00 944.0
11 TraesCS4B01G036300 chr4B 98.859 526 6 0 1 526 26075380 26074855 0.000000e+00 939.0
12 TraesCS4B01G036300 chr4B 98.859 526 6 0 1 526 26161444 26160919 0.000000e+00 939.0
13 TraesCS4B01G036300 chr4B 98.669 526 7 0 1 526 26111756 26111231 0.000000e+00 933.0
14 TraesCS4B01G036300 chr4B 98.669 526 7 0 1 526 26203413 26202888 0.000000e+00 933.0
15 TraesCS4B01G036300 chr4B 93.529 510 31 2 3 512 57440922 57441429 0.000000e+00 758.0
16 TraesCS4B01G036300 chr4B 98.947 190 2 0 523 712 26158948 26158759 9.320000e-90 340.0
17 TraesCS4B01G036300 chr4B 98.421 190 3 0 523 712 25983426 25983237 4.340000e-88 335.0
18 TraesCS4B01G036300 chr4B 98.421 190 3 0 523 712 26020952 26020763 4.340000e-88 335.0
19 TraesCS4B01G036300 chr4B 98.421 190 3 0 523 712 26109241 26109052 4.340000e-88 335.0
20 TraesCS4B01G036300 chr4B 96.316 190 7 0 523 712 26282192 26282003 2.030000e-81 313.0
21 TraesCS4B01G036300 chr4B 97.163 141 2 2 1670 1808 26017288 26017148 1.260000e-58 237.0
22 TraesCS4B01G036300 chr4B 95.620 137 4 1 718 854 25983169 25983035 4.560000e-53 219.0
23 TraesCS4B01G036300 chr4B 93.750 128 6 1 768 895 26352197 26352072 9.930000e-45 191.0
24 TraesCS4B01G036300 chrUn 97.778 1080 5 5 747 1808 382348023 382349101 0.000000e+00 1844.0
25 TraesCS4B01G036300 chrUn 75.450 444 90 13 996 1439 8090669 8091093 5.940000e-47 198.0
26 TraesCS4B01G036300 chr3B 96.381 525 17 1 1 525 223699081 223699603 0.000000e+00 863.0
27 TraesCS4B01G036300 chr2A 89.981 529 48 2 1 529 166087992 166087469 0.000000e+00 678.0
28 TraesCS4B01G036300 chr2A 100.000 40 0 0 621 660 205702356 205702317 1.040000e-09 75.0
29 TraesCS4B01G036300 chr4D 89.555 517 36 6 2204 2718 15530463 15529963 8.210000e-180 640.0
30 TraesCS4B01G036300 chr4D 93.269 208 7 3 1685 1891 15533637 15533436 1.580000e-77 300.0
31 TraesCS4B01G036300 chr4D 92.571 175 9 2 1955 2125 15533440 15533266 5.810000e-62 248.0
32 TraesCS4B01G036300 chr4D 87.209 172 15 6 1511 1676 15533924 15533754 3.570000e-44 189.0
33 TraesCS4B01G036300 chr4D 91.463 82 7 0 2120 2201 15533088 15533007 2.210000e-21 113.0
34 TraesCS4B01G036300 chr4D 97.619 42 1 0 718 759 15533984 15533943 3.750000e-09 73.1
35 TraesCS4B01G036300 chr4A 89.764 508 35 10 954 1459 585054523 585055015 3.820000e-178 634.0
36 TraesCS4B01G036300 chr4A 84.914 464 49 8 1211 1654 585060359 585060821 1.480000e-122 449.0
37 TraesCS4B01G036300 chr7B 79.038 291 39 9 2413 2694 194213785 194214062 2.150000e-41 180.0
38 TraesCS4B01G036300 chr7B 77.570 321 47 14 2403 2712 355704213 355704519 1.290000e-38 171.0
39 TraesCS4B01G036300 chr1D 78.214 280 39 12 2403 2671 235168802 235168534 2.800000e-35 159.0
40 TraesCS4B01G036300 chr3A 77.700 287 30 16 2403 2668 396646871 396647144 7.840000e-31 145.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G036300 chr4B 26240447 26243164 2717 True 5020.000000 5020 100.000000 1 2718 1 chr4B.!!$R1 2717
1 TraesCS4B01G036300 chr4B 26198730 26203413 4683 True 2406.000000 3879 98.544000 1 2718 2 chr4B.!!$R7 2717
2 TraesCS4B01G036300 chr4B 26070651 26075380 4729 True 2395.000000 3851 98.526000 1 2718 2 chr4B.!!$R4 2717
3 TraesCS4B01G036300 chr4B 26156688 26161444 4756 True 1631.333333 3615 99.019000 1 2718 3 chr4B.!!$R6 2717
4 TraesCS4B01G036300 chr4B 26279950 26284707 4757 True 1564.000000 3435 97.800333 1 2685 3 chr4B.!!$R8 2684
5 TraesCS4B01G036300 chr4B 25981487 25983426 1939 True 1070.666667 2658 97.262333 523 2718 3 chr4B.!!$R2 2195
6 TraesCS4B01G036300 chr4B 26017148 26023467 6319 True 948.750000 2279 97.908500 1 2718 4 chr4B.!!$R3 2717
7 TraesCS4B01G036300 chr4B 26108385 26111756 3371 True 786.666667 1092 98.863333 1 1317 3 chr4B.!!$R5 1316
8 TraesCS4B01G036300 chr4B 57440922 57441429 507 False 758.000000 758 93.529000 3 512 1 chr4B.!!$F1 509
9 TraesCS4B01G036300 chr4B 26351209 26352197 988 True 651.500000 1112 94.033500 768 1671 2 chr4B.!!$R9 903
10 TraesCS4B01G036300 chrUn 382348023 382349101 1078 False 1844.000000 1844 97.778000 747 1808 1 chrUn.!!$F2 1061
11 TraesCS4B01G036300 chr3B 223699081 223699603 522 False 863.000000 863 96.381000 1 525 1 chr3B.!!$F1 524
12 TraesCS4B01G036300 chr2A 166087469 166087992 523 True 678.000000 678 89.981000 1 529 1 chr2A.!!$R1 528
13 TraesCS4B01G036300 chr4D 15529963 15533984 4021 True 260.516667 640 91.947667 718 2718 6 chr4D.!!$R1 2000

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
145 146 4.613437 AGGATGTATGTGGCAAGGAAATT 58.387 39.130 0.0 0.0 0.0 1.82 F
1713 4316 4.034742 GGCGCGAGAATAAAAGACCAATAA 59.965 41.667 12.1 0.0 0.0 1.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 4316 2.815211 CATGCAGCTACCGCACGT 60.815 61.111 0.00 0.00 43.35 4.49 R
2649 7983 3.049344 ACCCTTCTAAATCCTAGGCCTG 58.951 50.000 17.99 5.26 0.00 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
145 146 4.613437 AGGATGTATGTGGCAAGGAAATT 58.387 39.130 0.00 0.0 0.00 1.82
1713 4316 4.034742 GGCGCGAGAATAAAAGACCAATAA 59.965 41.667 12.10 0.0 0.00 1.40
1819 4422 1.823169 TAGCGGTTCCGGCTGTTCTT 61.823 55.000 13.16 0.0 41.69 2.52
2210 7541 0.613777 GGGACGTGGGAACTGATCTT 59.386 55.000 0.00 0.0 0.00 2.40
2623 7957 2.862536 CCACATGATCTGTTGACTAGCG 59.137 50.000 0.00 0.0 35.29 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.411446 ACAAGCAAACCATCGATCAAGA 58.589 40.909 0.00 0.00 0.00 3.02
145 146 7.872061 AACATGGATGTAGTGATAATCCCTA 57.128 36.000 0.00 0.00 40.80 3.53
1713 4316 2.815211 CATGCAGCTACCGCACGT 60.815 61.111 0.00 0.00 43.35 4.49
1819 4422 3.951775 AAGATTGCAATTAACGGCCAA 57.048 38.095 14.33 0.00 0.00 4.52
2210 7541 3.965258 ACCATGCGTCCTTGCCCA 61.965 61.111 0.00 0.00 0.00 5.36
2623 7957 5.350640 GGTGCATTATATAAACCGAGGCTAC 59.649 44.000 0.00 0.00 0.00 3.58
2649 7983 3.049344 ACCCTTCTAAATCCTAGGCCTG 58.951 50.000 17.99 5.26 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.