Multiple sequence alignment - TraesCS4B01G036200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G036200 chr4B 100.000 2691 0 0 1 2691 26201464 26198774 0.000000e+00 4970.0
1 TraesCS4B01G036200 chr4B 98.737 2691 34 0 1 2691 26073385 26070695 0.000000e+00 4782.0
2 TraesCS4B01G036200 chr4B 98.387 2170 17 2 522 2691 26242642 26240491 0.000000e+00 3797.0
3 TraesCS4B01G036200 chr4B 99.241 1975 15 0 717 2691 26281935 26279961 0.000000e+00 3565.0
4 TraesCS4B01G036200 chr4B 98.380 1975 17 1 717 2691 26158691 26156732 0.000000e+00 3456.0
5 TraesCS4B01G036200 chr4B 99.072 1509 14 0 1183 2691 25983039 25981531 0.000000e+00 2710.0
6 TraesCS4B01G036200 chr4B 98.262 1323 21 2 1371 2691 26020717 26019395 0.000000e+00 2314.0
7 TraesCS4B01G036200 chr4B 98.453 711 11 0 1 711 26159469 26158759 0.000000e+00 1253.0
8 TraesCS4B01G036200 chr4B 98.172 711 13 0 1 711 25983947 25983237 0.000000e+00 1242.0
9 TraesCS4B01G036200 chr4B 98.172 711 13 0 1 711 26109762 26109052 0.000000e+00 1242.0
10 TraesCS4B01G036200 chr4B 98.031 711 14 0 1 711 26282713 26282003 0.000000e+00 1236.0
11 TraesCS4B01G036200 chr4B 98.031 711 13 1 1 711 26021472 26020763 0.000000e+00 1234.0
12 TraesCS4B01G036200 chr4B 96.346 739 21 2 947 1685 26351941 26351209 0.000000e+00 1210.0
13 TraesCS4B01G036200 chr4B 99.333 600 4 0 717 1316 26108984 26108385 0.000000e+00 1086.0
14 TraesCS4B01G036200 chr4B 97.872 141 1 2 1684 1822 26017288 26017148 2.680000e-60 243.0
15 TraesCS4B01G036200 chr4B 96.350 137 3 1 717 853 25983169 25983035 9.700000e-55 224.0
16 TraesCS4B01G036200 chr4B 92.969 128 7 2 767 894 26352197 26352072 4.580000e-43 185.0
17 TraesCS4B01G036200 chr4B 82.292 96 13 3 555 647 22230075 22230169 2.220000e-11 80.5
18 TraesCS4B01G036200 chrUn 98.981 1080 7 4 746 1822 382348023 382349101 0.000000e+00 1930.0
19 TraesCS4B01G036200 chrUn 75.730 445 87 15 995 1438 8090669 8091093 1.260000e-48 204.0
20 TraesCS4B01G036200 chr4A 90.157 508 33 10 953 1458 585054523 585055015 0.000000e+00 645.0
21 TraesCS4B01G036200 chr5B 89.892 465 42 4 3 464 225509256 225509718 6.410000e-166 593.0
22 TraesCS4B01G036200 chr4D 91.587 416 33 2 2277 2691 15530421 15530007 8.360000e-160 573.0
23 TraesCS4B01G036200 chr4D 93.839 211 6 3 1699 1908 15533637 15533433 7.230000e-81 311.0
24 TraesCS4B01G036200 chr4D 92.000 175 10 2 1969 2139 15533440 15533266 2.680000e-60 243.0
25 TraesCS4B01G036200 chr4D 86.628 172 16 6 1525 1690 15533924 15533754 1.650000e-42 183.0
26 TraesCS4B01G036200 chr4D 91.463 82 7 0 2134 2215 15533088 15533007 2.190000e-21 113.0
27 TraesCS4B01G036200 chr4D 100.000 42 0 0 717 758 15533984 15533943 7.990000e-11 78.7
28 TraesCS4B01G036200 chr4D 95.349 43 2 0 2218 2260 15530463 15530421 4.810000e-08 69.4
29 TraesCS4B01G036200 chr7D 92.515 334 25 0 131 464 91581814 91581481 1.870000e-131 479.0
30 TraesCS4B01G036200 chr7D 89.744 234 20 3 3 233 91582048 91581816 2.030000e-76 296.0
31 TraesCS4B01G036200 chr3A 82.873 181 23 6 2506 2680 469345829 469345651 3.590000e-34 156.0
32 TraesCS4B01G036200 chr3A 82.667 75 12 1 586 659 390142566 390142492 6.220000e-07 65.8
33 TraesCS4B01G036200 chr1D 77.936 281 41 12 2417 2688 235168802 235168534 3.590000e-34 156.0
34 TraesCS4B01G036200 chr3B 81.667 180 26 5 2508 2682 591673857 591674034 2.790000e-30 143.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G036200 chr4B 26198774 26201464 2690 True 4970.000000 4970 100.000000 1 2691 1 chr4B.!!$R2 2690
1 TraesCS4B01G036200 chr4B 26070695 26073385 2690 True 4782.000000 4782 98.737000 1 2691 1 chr4B.!!$R1 2690
2 TraesCS4B01G036200 chr4B 26240491 26242642 2151 True 3797.000000 3797 98.387000 522 2691 1 chr4B.!!$R3 2169
3 TraesCS4B01G036200 chr4B 26279961 26282713 2752 True 2400.500000 3565 98.636000 1 2691 2 chr4B.!!$R8 2690
4 TraesCS4B01G036200 chr4B 26156732 26159469 2737 True 2354.500000 3456 98.416500 1 2691 2 chr4B.!!$R7 2690
5 TraesCS4B01G036200 chr4B 25981531 25983947 2416 True 1392.000000 2710 97.864667 1 2691 3 chr4B.!!$R4 2690
6 TraesCS4B01G036200 chr4B 26017148 26021472 4324 True 1263.666667 2314 98.055000 1 2691 3 chr4B.!!$R5 2690
7 TraesCS4B01G036200 chr4B 26108385 26109762 1377 True 1164.000000 1242 98.752500 1 1316 2 chr4B.!!$R6 1315
8 TraesCS4B01G036200 chr4B 26351209 26352197 988 True 697.500000 1210 94.657500 767 1685 2 chr4B.!!$R9 918
9 TraesCS4B01G036200 chrUn 382348023 382349101 1078 False 1930.000000 1930 98.981000 746 1822 1 chrUn.!!$F2 1076
10 TraesCS4B01G036200 chr4D 15530007 15533984 3977 True 224.442857 573 92.980857 717 2691 7 chr4D.!!$R1 1974
11 TraesCS4B01G036200 chr7D 91581481 91582048 567 True 387.500000 479 91.129500 3 464 2 chr7D.!!$R1 461

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
492 599 2.035576 GCCCAAGTAATATCGGACGTCT 59.964 50.0 16.46 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1937 2297 3.871006 GTCGTGAGGTCAATGCATTCATA 59.129 43.478 9.53 0.0 31.46 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 105 4.533311 AGGCCAAATGAAACAAGAATCCAT 59.467 37.500 5.01 0.0 0.00 3.41
146 150 5.468592 TGACGGGAAACAAATGAATGAATG 58.531 37.500 0.00 0.0 0.00 2.67
345 452 3.951979 CAGAATGTTCAAGGCGATACC 57.048 47.619 0.00 0.0 39.61 2.73
492 599 2.035576 GCCCAAGTAATATCGGACGTCT 59.964 50.000 16.46 0.0 0.00 4.18
1937 2297 4.074970 CTCAACACCTTTCAAGCTACCAT 58.925 43.478 0.00 0.0 0.00 3.55
1974 2334 1.118965 ACGACACATGTCACCCTCCA 61.119 55.000 12.32 0.0 44.99 3.86
2618 5708 9.547753 ACATGTATCTACCACAAGATTGTAATC 57.452 33.333 0.00 0.0 39.91 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 105 0.895530 GTCCTCTTCGGATGTGGACA 59.104 55.000 27.02 5.26 45.44 4.02
146 150 6.183360 CCCCAACTCAAGTATGTGATTGATTC 60.183 42.308 0.00 0.00 35.04 2.52
345 452 3.626217 CCACCATCATCTGTCTCACATTG 59.374 47.826 0.00 0.00 0.00 2.82
492 599 2.483877 CGCTGCTCCAGTGACATTTTTA 59.516 45.455 0.00 0.00 43.78 1.52
520 627 7.305304 CGTTACTATTAAGAAGCGCTAACTGTC 60.305 40.741 12.05 3.59 0.00 3.51
868 1037 0.889994 TGCCATGAAGTGAACCATGC 59.110 50.000 0.00 0.00 38.95 4.06
1937 2297 3.871006 GTCGTGAGGTCAATGCATTCATA 59.129 43.478 9.53 0.00 31.46 2.15
2618 5708 3.201290 GCTAGTCAACAGATCATGTGGG 58.799 50.000 0.00 0.00 43.00 4.61
2666 5756 3.749036 ACCCTTCTAAATCCTAGGCCTT 58.251 45.455 12.58 1.99 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.