Multiple sequence alignment - TraesCS4B01G036100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G036100 chr4B 100.000 2673 0 0 1 2673 26159404 26156732 0.000000e+00 4937.0
1 TraesCS4B01G036100 chr4B 98.400 2688 28 1 1 2673 26282648 26279961 0.000000e+00 4711.0
2 TraesCS4B01G036100 chr4B 99.235 1960 12 1 714 2673 26242447 26240491 0.000000e+00 3533.0
3 TraesCS4B01G036100 chr4B 98.380 1975 17 1 714 2673 26200748 26198774 0.000000e+00 3456.0
4 TraesCS4B01G036100 chr4B 98.177 1975 21 1 714 2673 26072669 26070695 0.000000e+00 3434.0
5 TraesCS4B01G036100 chr4B 97.813 1509 18 1 1180 2673 25983039 25981531 0.000000e+00 2590.0
6 TraesCS4B01G036100 chr4B 99.162 1313 11 0 1 1313 26109697 26108385 0.000000e+00 2364.0
7 TraesCS4B01G036100 chr4B 97.128 1323 21 3 1368 2673 26020717 26019395 0.000000e+00 2217.0
8 TraesCS4B01G036100 chr4B 98.235 850 13 1 1 850 25983882 25983035 0.000000e+00 1485.0
9 TraesCS4B01G036100 chr4B 98.571 700 9 1 1 700 26021407 26020709 0.000000e+00 1236.0
10 TraesCS4B01G036100 chr4B 99.536 646 3 0 1 646 26073320 26072675 0.000000e+00 1177.0
11 TraesCS4B01G036100 chr4B 98.607 646 9 0 1 646 26201399 26200754 0.000000e+00 1144.0
12 TraesCS4B01G036100 chr4B 94.181 739 22 3 944 1667 26351941 26351209 0.000000e+00 1107.0
13 TraesCS4B01G036100 chr4B 98.947 190 2 0 457 646 26242642 26242453 9.160000e-90 340.0
14 TraesCS4B01G036100 chr4B 97.872 141 1 2 1666 1804 26017288 26017148 2.660000e-60 243.0
15 TraesCS4B01G036100 chr4B 93.750 128 6 1 764 891 26352197 26352072 9.770000e-45 191.0
16 TraesCS4B01G036100 chrUn 97.778 1080 5 5 743 1804 382348023 382349101 0.000000e+00 1844.0
17 TraesCS4B01G036100 chrUn 75.450 444 90 13 992 1435 8090669 8091093 5.840000e-47 198.0
18 TraesCS4B01G036100 chr4A 89.764 508 35 10 950 1455 585054523 585055015 3.750000e-178 634.0
19 TraesCS4B01G036100 chr4A 84.698 464 50 8 1207 1650 585060359 585060821 6.790000e-121 444.0
20 TraesCS4B01G036100 chr4A 87.857 140 12 2 597 731 585054086 585054225 2.750000e-35 159.0
21 TraesCS4B01G036100 chr4D 91.827 416 32 2 2259 2673 15530421 15530007 1.780000e-161 579.0
22 TraesCS4B01G036100 chr4D 93.750 208 6 3 1681 1887 15533637 15533436 3.340000e-79 305.0
23 TraesCS4B01G036100 chr4D 92.000 175 10 2 1951 2121 15533440 15533266 2.660000e-60 243.0
24 TraesCS4B01G036100 chr4D 92.593 162 9 2 597 755 15534104 15533943 2.070000e-56 230.0
25 TraesCS4B01G036100 chr4D 86.628 172 16 6 1507 1672 15533924 15533754 1.630000e-42 183.0
26 TraesCS4B01G036100 chr4D 91.463 82 7 0 2116 2197 15533088 15533007 2.170000e-21 113.0
27 TraesCS4B01G036100 chr4D 95.349 43 2 0 2200 2242 15530463 15530421 4.770000e-08 69.4
28 TraesCS4B01G036100 chr5B 90.226 399 38 1 1 399 225509321 225509718 1.100000e-143 520.0
29 TraesCS4B01G036100 chr5B 85.052 194 22 3 399 588 225510004 225510194 9.770000e-45 191.0
30 TraesCS4B01G036100 chr7D 92.814 334 24 0 66 399 91581814 91581481 4.000000e-133 484.0
31 TraesCS4B01G036100 chr7D 91.071 168 14 1 1 168 91581982 91581816 2.680000e-55 226.0
32 TraesCS4B01G036100 chr7D 86.500 200 20 4 399 594 91581174 91580978 2.080000e-51 213.0
33 TraesCS4B01G036100 chr7B 79.273 275 34 13 2399 2665 355704213 355704472 1.270000e-38 171.0
34 TraesCS4B01G036100 chr3A 83.978 181 21 6 2488 2662 469345829 469345651 1.650000e-37 167.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G036100 chr4B 26156732 26159404 2672 True 4937.000000 4937 100.000000 1 2673 1 chr4B.!!$R2 2672
1 TraesCS4B01G036100 chr4B 26279961 26282648 2687 True 4711.000000 4711 98.400000 1 2673 1 chr4B.!!$R3 2672
2 TraesCS4B01G036100 chr4B 26108385 26109697 1312 True 2364.000000 2364 99.162000 1 1313 1 chr4B.!!$R1 1312
3 TraesCS4B01G036100 chr4B 26070695 26073320 2625 True 2305.500000 3434 98.856500 1 2673 2 chr4B.!!$R6 2672
4 TraesCS4B01G036100 chr4B 26198774 26201399 2625 True 2300.000000 3456 98.493500 1 2673 2 chr4B.!!$R7 2672
5 TraesCS4B01G036100 chr4B 25981531 25983882 2351 True 2037.500000 2590 98.024000 1 2673 2 chr4B.!!$R4 2672
6 TraesCS4B01G036100 chr4B 26240491 26242642 2151 True 1936.500000 3533 99.091000 457 2673 2 chr4B.!!$R8 2216
7 TraesCS4B01G036100 chr4B 26017148 26021407 4259 True 1232.000000 2217 97.857000 1 2673 3 chr4B.!!$R5 2672
8 TraesCS4B01G036100 chr4B 26351209 26352197 988 True 649.000000 1107 93.965500 764 1667 2 chr4B.!!$R9 903
9 TraesCS4B01G036100 chrUn 382348023 382349101 1078 False 1844.000000 1844 97.778000 743 1804 1 chrUn.!!$F2 1061
10 TraesCS4B01G036100 chr4A 585054086 585055015 929 False 396.500000 634 88.810500 597 1455 2 chr4A.!!$F2 858
11 TraesCS4B01G036100 chr4D 15530007 15534104 4097 True 246.057143 579 91.944286 597 2673 7 chr4D.!!$R1 2076
12 TraesCS4B01G036100 chr5B 225509321 225510194 873 False 355.500000 520 87.639000 1 588 2 chr5B.!!$F1 587
13 TraesCS4B01G036100 chr7D 91580978 91581982 1004 True 307.666667 484 90.128333 1 594 3 chr7D.!!$R1 593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
379 483 0.680921 CCACCTACGGTTACGGGAGA 60.681 60.0 3.57 0.0 46.48 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2736 4.994852 TCATTACGAAAGACAGGGTTCAAG 59.005 41.667 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
379 483 0.680921 CCACCTACGGTTACGGGAGA 60.681 60.000 3.57 0.0 46.48 3.71
1846 2549 9.520204 CGTTAATTGCAATCTTATGGATTTTCT 57.480 29.630 13.38 0.0 42.20 2.52
2030 2736 2.029649 TGAAACGGAGGTAGTAGTGTGC 60.030 50.000 0.00 0.0 0.00 4.57
2430 5861 6.426937 GCTAAATTCGGCATATCTTGAGGTAA 59.573 38.462 0.00 0.0 0.00 2.85
2435 5866 3.181454 CGGCATATCTTGAGGTAAGGGTT 60.181 47.826 0.00 0.0 37.01 4.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
379 483 1.404315 GGATGAAGCTCGACGGTCTTT 60.404 52.381 6.57 0.0 0.00 2.52
2030 2736 4.994852 TCATTACGAAAGACAGGGTTCAAG 59.005 41.667 0.00 0.0 0.00 3.02
2430 5861 2.817665 AGACGCCTAACTTAGAACCCT 58.182 47.619 0.00 0.0 0.00 4.34
2435 5866 3.365666 CGTGTCAAGACGCCTAACTTAGA 60.366 47.826 8.06 0.0 38.53 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.