Multiple sequence alignment - TraesCS4B01G035900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G035900 chr4B 100.000 2600 0 0 1 2600 26073344 26070745 0.000000e+00 4802.0
1 TraesCS4B01G035900 chr4B 98.769 2600 32 0 1 2600 26201423 26198824 0.000000e+00 4625.0
2 TraesCS4B01G035900 chr4B 98.254 2119 19 2 481 2599 26242642 26240542 0.000000e+00 3692.0
3 TraesCS4B01G035900 chr4B 98.753 1925 24 0 676 2600 26281935 26280011 0.000000e+00 3422.0
4 TraesCS4B01G035900 chr4B 98.130 1925 21 1 676 2600 26158691 26156782 0.000000e+00 3341.0
5 TraesCS4B01G035900 chr4B 98.629 1459 20 0 1142 2600 25983039 25981581 0.000000e+00 2584.0
6 TraesCS4B01G035900 chr4B 97.643 1273 28 2 1330 2600 26020717 26019445 0.000000e+00 2183.0
7 TraesCS4B01G035900 chr4B 99.403 670 4 0 1 670 26159428 26158759 0.000000e+00 1216.0
8 TraesCS4B01G035900 chr4B 96.346 739 21 2 906 1644 26351941 26351209 0.000000e+00 1210.0
9 TraesCS4B01G035900 chr4B 98.507 670 10 0 1 670 26282672 26282003 0.000000e+00 1182.0
10 TraesCS4B01G035900 chr4B 98.507 670 9 1 1 670 26021431 26020763 0.000000e+00 1181.0
11 TraesCS4B01G035900 chr4B 98.358 670 11 0 1 670 25983906 25983237 0.000000e+00 1177.0
12 TraesCS4B01G035900 chr4B 98.358 670 11 0 1 670 26109721 26109052 0.000000e+00 1177.0
13 TraesCS4B01G035900 chr4B 99.500 600 3 0 676 1275 26108984 26108385 0.000000e+00 1092.0
14 TraesCS4B01G035900 chr4B 95.745 141 4 2 1643 1781 26017288 26017148 2.600000e-55 226.0
15 TraesCS4B01G035900 chr4B 95.745 141 4 2 1643 1781 26068536 26068396 2.600000e-55 226.0
16 TraesCS4B01G035900 chr4B 95.620 137 4 1 676 812 25983169 25983035 4.360000e-53 219.0
17 TraesCS4B01G035900 chr4B 93.750 128 6 1 726 853 26352197 26352072 9.500000e-45 191.0
18 TraesCS4B01G035900 chr4B 83.333 96 12 3 514 606 22230075 22230169 4.610000e-13 86.1
19 TraesCS4B01G035900 chrUn 98.981 1080 7 4 705 1781 382348023 382349101 0.000000e+00 1930.0
20 TraesCS4B01G035900 chrUn 75.506 445 88 15 954 1397 8090669 8091093 5.680000e-47 198.0
21 TraesCS4B01G035900 chr4A 89.961 508 34 10 912 1417 585054523 585055015 7.850000e-180 640.0
22 TraesCS4B01G035900 chr4A 87.716 464 51 3 1169 1627 585060359 585060821 1.060000e-148 536.0
23 TraesCS4B01G035900 chr4A 81.111 180 21 6 2396 2575 567450665 567450831 5.840000e-27 132.0
24 TraesCS4B01G035900 chr5B 90.802 424 37 2 1 423 225509296 225509718 1.350000e-157 566.0
25 TraesCS4B01G035900 chr5B 84.536 194 23 3 423 612 225510004 225510194 4.420000e-43 185.0
26 TraesCS4B01G035900 chr5B 96.875 32 0 1 2068 2098 67490408 67490377 5.000000e-03 52.8
27 TraesCS4B01G035900 chr7D 93.413 334 22 0 90 423 91581814 91581481 1.800000e-136 496.0
28 TraesCS4B01G035900 chr7D 91.710 193 14 2 1 192 91582007 91581816 1.530000e-67 267.0
29 TraesCS4B01G035900 chr4D 87.264 424 37 7 2177 2600 15530463 15530057 3.920000e-128 468.0
30 TraesCS4B01G035900 chr4D 92.417 211 9 3 1658 1867 15533637 15533433 7.040000e-76 294.0
31 TraesCS4B01G035900 chr4D 91.429 175 11 2 1928 2098 15533440 15533266 1.200000e-58 237.0
32 TraesCS4B01G035900 chr4D 91.463 82 7 0 2093 2174 15533088 15533007 2.110000e-21 113.0
33 TraesCS4B01G035900 chr4D 97.619 42 1 0 676 717 15533984 15533943 3.590000e-09 73.1
34 TraesCS4B01G035900 chr7B 82.873 181 19 5 2386 2566 194213785 194213953 4.480000e-33 152.0
35 TraesCS4B01G035900 chr1D 80.402 199 23 9 2376 2572 235168802 235168618 1.250000e-28 137.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G035900 chr4B 26198824 26201423 2599 True 4625.000000 4625 98.769000 1 2600 1 chr4B.!!$R1 2599
1 TraesCS4B01G035900 chr4B 26240542 26242642 2100 True 3692.000000 3692 98.254000 481 2599 1 chr4B.!!$R2 2118
2 TraesCS4B01G035900 chr4B 26068396 26073344 4948 True 2514.000000 4802 97.872500 1 2600 2 chr4B.!!$R5 2599
3 TraesCS4B01G035900 chr4B 26280011 26282672 2661 True 2302.000000 3422 98.630000 1 2600 2 chr4B.!!$R8 2599
4 TraesCS4B01G035900 chr4B 26156782 26159428 2646 True 2278.500000 3341 98.766500 1 2600 2 chr4B.!!$R7 2599
5 TraesCS4B01G035900 chr4B 25981581 25983906 2325 True 1326.666667 2584 97.535667 1 2600 3 chr4B.!!$R3 2599
6 TraesCS4B01G035900 chr4B 26017148 26021431 4283 True 1196.666667 2183 97.298333 1 2600 3 chr4B.!!$R4 2599
7 TraesCS4B01G035900 chr4B 26108385 26109721 1336 True 1134.500000 1177 98.929000 1 1275 2 chr4B.!!$R6 1274
8 TraesCS4B01G035900 chr4B 26351209 26352197 988 True 700.500000 1210 95.048000 726 1644 2 chr4B.!!$R9 918
9 TraesCS4B01G035900 chrUn 382348023 382349101 1078 False 1930.000000 1930 98.981000 705 1781 1 chrUn.!!$F2 1076
10 TraesCS4B01G035900 chr5B 225509296 225510194 898 False 375.500000 566 87.669000 1 612 2 chr5B.!!$F1 611
11 TraesCS4B01G035900 chr7D 91581481 91582007 526 True 381.500000 496 92.561500 1 423 2 chr7D.!!$R1 422
12 TraesCS4B01G035900 chr4D 15530057 15533984 3927 True 237.020000 468 92.038400 676 2600 5 chr4D.!!$R1 1924

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
451 843 2.035576 GCCCAAGTAATATCGGACGTCT 59.964 50.0 16.46 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1896 2544 3.871006 GTCGTGAGGTCAATGCATTCATA 59.129 43.478 9.53 0.0 31.46 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 62 4.533311 AGGCCAAATGAAACAAGAATCCAT 59.467 37.500 5.01 0.0 0.00 3.41
105 107 5.468592 TGACGGGAAACAAATGAATGAATG 58.531 37.500 0.00 0.0 0.00 2.67
304 409 3.951979 CAGAATGTTCAAGGCGATACC 57.048 47.619 0.00 0.0 39.61 2.73
451 843 2.035576 GCCCAAGTAATATCGGACGTCT 59.964 50.000 16.46 0.0 0.00 4.18
1896 2544 4.074970 CTCAACACCTTTCAAGCTACCAT 58.925 43.478 0.00 0.0 0.00 3.55
1933 2581 1.118965 ACGACACATGTCACCCTCCA 61.119 55.000 12.32 0.0 44.99 3.86
2577 5955 9.547753 ACATGTATCTACCACAAGATTGTAATC 57.452 33.333 0.00 0.0 39.91 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 62 0.895530 GTCCTCTTCGGATGTGGACA 59.104 55.000 27.02 5.26 45.44 4.02
105 107 6.183360 CCCCAACTCAAGTATGTGATTGATTC 60.183 42.308 0.00 0.00 35.04 2.52
304 409 3.626217 CCACCATCATCTGTCTCACATTG 59.374 47.826 0.00 0.00 0.00 2.82
451 843 2.483877 CGCTGCTCCAGTGACATTTTTA 59.516 45.455 0.00 0.00 43.78 1.52
479 871 7.305304 CGTTACTATTAAGAAGCGCTAACTGTC 60.305 40.741 12.05 3.59 0.00 3.51
827 1284 0.889994 TGCCATGAAGTGAACCATGC 59.110 50.000 0.00 0.00 38.95 4.06
1896 2544 3.871006 GTCGTGAGGTCAATGCATTCATA 59.129 43.478 9.53 0.00 31.46 2.15
2577 5955 3.201290 GCTAGTCAACAGATCATGTGGG 58.799 50.000 0.00 0.00 43.00 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.