Multiple sequence alignment - TraesCS4B01G024100
BLAST Results
Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.
qseqid | sseqid | percentage.identical | alignment.length | no.mismatch | no.gap.openings | qstart | qend | sstart | send | evalue | bitscore | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | TraesCS4B01G024100 | chr4B | 100.000 | 5788 | 0 | 0 | 789 | 6576 | 17253426 | 17259213 | 0.000000e+00 | 10689.0 |
1 | TraesCS4B01G024100 | chr4B | 84.424 | 642 | 72 | 18 | 4565 | 5190 | 17269817 | 17270446 | 2.030000e-169 | 606.0 |
2 | TraesCS4B01G024100 | chr4B | 85.714 | 483 | 42 | 12 | 3009 | 3467 | 17268943 | 17269422 | 9.910000e-133 | 484.0 |
3 | TraesCS4B01G024100 | chr4B | 100.000 | 257 | 0 | 0 | 1 | 257 | 17252638 | 17252894 | 5.970000e-130 | 475.0 |
4 | TraesCS4B01G024100 | chr4B | 90.323 | 217 | 21 | 0 | 4079 | 4295 | 17269596 | 17269812 | 1.080000e-72 | 285.0 |
5 | TraesCS4B01G024100 | chr4B | 84.571 | 175 | 17 | 3 | 3878 | 4052 | 17269432 | 17269596 | 1.470000e-36 | 165.0 |
6 | TraesCS4B01G024100 | chr4B | 96.842 | 95 | 3 | 0 | 3560 | 3654 | 17256265 | 17256359 | 6.830000e-35 | 159.0 |
7 | TraesCS4B01G024100 | chr4B | 92.727 | 110 | 8 | 0 | 6137 | 6246 | 143309972 | 143310081 | 6.830000e-35 | 159.0 |
8 | TraesCS4B01G024100 | chr4B | 90.909 | 110 | 10 | 0 | 6137 | 6246 | 649602037 | 649601928 | 1.480000e-31 | 148.0 |
9 | TraesCS4B01G024100 | chr4B | 98.387 | 62 | 1 | 0 | 3819 | 3880 | 2196069 | 2196130 | 6.970000e-20 | 110.0 |
10 | TraesCS4B01G024100 | chr4B | 85.047 | 107 | 12 | 3 | 3507 | 3613 | 142519131 | 142519233 | 9.020000e-19 | 106.0 |
11 | TraesCS4B01G024100 | chr4A | 91.375 | 2632 | 150 | 31 | 790 | 3406 | 594166887 | 594164318 | 0.000000e+00 | 3531.0 |
12 | TraesCS4B01G024100 | chr4A | 91.559 | 2168 | 117 | 30 | 3878 | 6018 | 594164288 | 594162160 | 0.000000e+00 | 2929.0 |
13 | TraesCS4B01G024100 | chr4A | 83.437 | 483 | 50 | 14 | 3009 | 3467 | 594152258 | 594151782 | 7.880000e-114 | 422.0 |
14 | TraesCS4B01G024100 | chr4A | 87.649 | 251 | 17 | 5 | 3 | 252 | 594167625 | 594167388 | 5.020000e-71 | 279.0 |
15 | TraesCS4B01G024100 | chr4A | 95.385 | 130 | 6 | 0 | 4565 | 4694 | 594151388 | 594151259 | 2.400000e-49 | 207.0 |
16 | TraesCS4B01G024100 | chr4A | 82.684 | 231 | 34 | 6 | 2008 | 2237 | 546609592 | 546609367 | 4.020000e-47 | 200.0 |
17 | TraesCS4B01G024100 | chr4A | 95.370 | 108 | 5 | 0 | 6450 | 6557 | 594161686 | 594161579 | 8.770000e-39 | 172.0 |
18 | TraesCS4B01G024100 | chr4A | 84.571 | 175 | 16 | 4 | 3878 | 4052 | 594151772 | 594151609 | 5.280000e-36 | 163.0 |
19 | TraesCS4B01G024100 | chr4A | 97.753 | 89 | 2 | 0 | 6329 | 6417 | 594161874 | 594161786 | 3.180000e-33 | 154.0 |
20 | TraesCS4B01G024100 | chr4A | 89.908 | 109 | 10 | 1 | 2129 | 2237 | 546576062 | 546575955 | 8.890000e-29 | 139.0 |
21 | TraesCS4B01G024100 | chr4A | 85.271 | 129 | 13 | 5 | 1826 | 1948 | 546635798 | 546635670 | 1.920000e-25 | 128.0 |
22 | TraesCS4B01G024100 | chr4D | 93.013 | 1975 | 85 | 23 | 1515 | 3468 | 9249048 | 9250990 | 0.000000e+00 | 2833.0 |
23 | TraesCS4B01G024100 | chr4D | 94.419 | 1505 | 63 | 11 | 3878 | 5379 | 9251001 | 9252487 | 0.000000e+00 | 2294.0 |
24 | TraesCS4B01G024100 | chr4D | 84.177 | 632 | 49 | 9 | 5415 | 6018 | 9252485 | 9253093 | 3.440000e-157 | 566.0 |
25 | TraesCS4B01G024100 | chr4D | 89.831 | 413 | 23 | 9 | 916 | 1321 | 9248627 | 9249027 | 4.550000e-141 | 512.0 |
26 | TraesCS4B01G024100 | chr4D | 79.085 | 765 | 121 | 28 | 2238 | 2975 | 28237046 | 28237798 | 2.130000e-134 | 490.0 |
27 | TraesCS4B01G024100 | chr4D | 85.253 | 434 | 52 | 9 | 4765 | 5194 | 9263735 | 9264160 | 2.820000e-118 | 436.0 |
28 | TraesCS4B01G024100 | chr4D | 83.644 | 483 | 49 | 14 | 3009 | 3467 | 9262727 | 9263203 | 1.690000e-115 | 427.0 |
29 | TraesCS4B01G024100 | chr4D | 91.954 | 261 | 20 | 1 | 3627 | 3887 | 72840887 | 72840628 | 1.350000e-96 | 364.0 |
30 | TraesCS4B01G024100 | chr4D | 91.244 | 217 | 19 | 0 | 4079 | 4295 | 9263376 | 9263592 | 4.990000e-76 | 296.0 |
31 | TraesCS4B01G024100 | chr4D | 90.278 | 216 | 19 | 2 | 1 | 216 | 9247824 | 9248037 | 1.400000e-71 | 281.0 |
32 | TraesCS4B01G024100 | chr4D | 95.385 | 130 | 6 | 0 | 4565 | 4694 | 9263597 | 9263726 | 2.400000e-49 | 207.0 |
33 | TraesCS4B01G024100 | chr4D | 82.927 | 246 | 17 | 9 | 6329 | 6551 | 9253274 | 9253517 | 1.450000e-46 | 198.0 |
34 | TraesCS4B01G024100 | chr4D | 85.143 | 175 | 15 | 4 | 3878 | 4052 | 9263213 | 9263376 | 1.130000e-37 | 169.0 |
35 | TraesCS4B01G024100 | chr4D | 87.302 | 126 | 14 | 2 | 3560 | 3684 | 72840886 | 72840762 | 6.870000e-30 | 143.0 |
36 | TraesCS4B01G024100 | chr4D | 97.143 | 70 | 2 | 0 | 3819 | 3888 | 30403399 | 30403468 | 1.160000e-22 | 119.0 |
37 | TraesCS4B01G024100 | chr4D | 84.733 | 131 | 7 | 5 | 6450 | 6569 | 393249943 | 393249815 | 1.160000e-22 | 119.0 |
38 | TraesCS4B01G024100 | chr4D | 97.561 | 41 | 1 | 0 | 6462 | 6502 | 46659451 | 46659411 | 3.290000e-08 | 71.3 |
39 | TraesCS4B01G024100 | chr3D | 90.840 | 262 | 19 | 4 | 3626 | 3887 | 139470575 | 139470319 | 4.880000e-91 | 346.0 |
40 | TraesCS4B01G024100 | chr3D | 87.597 | 129 | 14 | 2 | 3557 | 3684 | 139470577 | 139470450 | 1.480000e-31 | 148.0 |
41 | TraesCS4B01G024100 | chr3D | 96.875 | 64 | 2 | 0 | 3819 | 3882 | 593115292 | 593115355 | 2.510000e-19 | 108.0 |
42 | TraesCS4B01G024100 | chr3D | 95.455 | 66 | 3 | 0 | 3819 | 3884 | 283321191 | 283321256 | 9.020000e-19 | 106.0 |
43 | TraesCS4B01G024100 | chr6B | 87.398 | 246 | 27 | 4 | 3630 | 3873 | 172239822 | 172239579 | 5.020000e-71 | 279.0 |
44 | TraesCS4B01G024100 | chr6B | 87.352 | 253 | 21 | 6 | 3627 | 3879 | 563489162 | 563489403 | 5.020000e-71 | 279.0 |
45 | TraesCS4B01G024100 | chr6B | 88.525 | 122 | 14 | 0 | 3560 | 3681 | 563489163 | 563489284 | 1.480000e-31 | 148.0 |
46 | TraesCS4B01G024100 | chr6B | 90.000 | 110 | 11 | 0 | 6137 | 6246 | 158284934 | 158285043 | 6.870000e-30 | 143.0 |
47 | TraesCS4B01G024100 | chr6B | 89.908 | 109 | 11 | 0 | 6137 | 6245 | 7147988 | 7147880 | 2.470000e-29 | 141.0 |
48 | TraesCS4B01G024100 | chr6B | 93.902 | 82 | 3 | 2 | 3618 | 3699 | 604398194 | 604398115 | 8.950000e-24 | 122.0 |
49 | TraesCS4B01G024100 | chr6B | 87.778 | 90 | 11 | 0 | 3461 | 3550 | 720759478 | 720759567 | 9.020000e-19 | 106.0 |
50 | TraesCS4B01G024100 | chr1A | 86.131 | 274 | 20 | 11 | 3624 | 3886 | 32188228 | 32187962 | 5.020000e-71 | 279.0 |
51 | TraesCS4B01G024100 | chr1A | 93.007 | 143 | 8 | 2 | 3679 | 3821 | 165453984 | 165454124 | 2.400000e-49 | 207.0 |
52 | TraesCS4B01G024100 | chr1A | 98.387 | 62 | 1 | 0 | 3819 | 3880 | 435066088 | 435066149 | 6.970000e-20 | 110.0 |
53 | TraesCS4B01G024100 | chr1A | 86.170 | 94 | 13 | 0 | 3465 | 3558 | 357765006 | 357764913 | 1.170000e-17 | 102.0 |
54 | TraesCS4B01G024100 | chr5D | 87.895 | 190 | 20 | 3 | 3633 | 3821 | 452850618 | 452850805 | 3.090000e-53 | 220.0 |
55 | TraesCS4B01G024100 | chr5D | 96.774 | 62 | 2 | 0 | 3819 | 3880 | 241844144 | 241844205 | 3.240000e-18 | 104.0 |
56 | TraesCS4B01G024100 | chr5D | 94.203 | 69 | 3 | 1 | 3819 | 3887 | 420186280 | 420186213 | 3.240000e-18 | 104.0 |
57 | TraesCS4B01G024100 | chr7B | 93.289 | 149 | 8 | 2 | 3696 | 3843 | 140609531 | 140609384 | 1.110000e-52 | 219.0 |
58 | TraesCS4B01G024100 | chr7B | 99.091 | 110 | 1 | 0 | 6017 | 6126 | 22070406 | 22070297 | 1.450000e-46 | 198.0 |
59 | TraesCS4B01G024100 | chr7B | 94.521 | 73 | 3 | 1 | 3819 | 3891 | 534583014 | 534583085 | 1.940000e-20 | 111.0 |
60 | TraesCS4B01G024100 | chr7B | 94.286 | 70 | 4 | 0 | 3819 | 3888 | 729606287 | 729606218 | 2.510000e-19 | 108.0 |
61 | TraesCS4B01G024100 | chr2A | 95.588 | 136 | 5 | 1 | 3689 | 3824 | 664604524 | 664604390 | 3.990000e-52 | 217.0 |
62 | TraesCS4B01G024100 | chr2A | 96.154 | 78 | 3 | 0 | 3626 | 3703 | 610002908 | 610002831 | 1.920000e-25 | 128.0 |
63 | TraesCS4B01G024100 | chr2A | 93.243 | 74 | 3 | 2 | 3819 | 3891 | 768677041 | 768677113 | 2.510000e-19 | 108.0 |
64 | TraesCS4B01G024100 | chr3B | 100.000 | 108 | 0 | 0 | 6016 | 6123 | 372486260 | 372486367 | 4.020000e-47 | 200.0 |
65 | TraesCS4B01G024100 | chr3B | 99.099 | 111 | 1 | 0 | 6014 | 6124 | 577429203 | 577429313 | 4.020000e-47 | 200.0 |
66 | TraesCS4B01G024100 | chr3B | 91.892 | 111 | 9 | 0 | 6137 | 6247 | 457968689 | 457968799 | 8.830000e-34 | 156.0 |
67 | TraesCS4B01G024100 | chr3B | 90.265 | 113 | 10 | 1 | 6137 | 6249 | 132389812 | 132389701 | 5.310000e-31 | 147.0 |
68 | TraesCS4B01G024100 | chr3B | 94.805 | 77 | 4 | 0 | 3620 | 3696 | 43965248 | 43965324 | 3.220000e-23 | 121.0 |
69 | TraesCS4B01G024100 | chr2B | 99.091 | 110 | 1 | 0 | 6014 | 6123 | 460807167 | 460807276 | 1.450000e-46 | 198.0 |
70 | TraesCS4B01G024100 | chr2B | 99.091 | 110 | 1 | 0 | 6014 | 6123 | 715014873 | 715014982 | 1.450000e-46 | 198.0 |
71 | TraesCS4B01G024100 | chr2B | 93.750 | 128 | 5 | 2 | 5999 | 6124 | 17430967 | 17431093 | 8.700000e-44 | 189.0 |
72 | TraesCS4B01G024100 | chr1B | 99.091 | 110 | 1 | 0 | 6015 | 6124 | 604145106 | 604145215 | 1.450000e-46 | 198.0 |
73 | TraesCS4B01G024100 | chr1B | 94.400 | 125 | 5 | 2 | 6008 | 6130 | 567372692 | 567372568 | 2.420000e-44 | 191.0 |
74 | TraesCS4B01G024100 | chr1B | 91.589 | 107 | 9 | 0 | 6140 | 6246 | 130628870 | 130628764 | 1.480000e-31 | 148.0 |
75 | TraesCS4B01G024100 | chr1B | 89.189 | 111 | 12 | 0 | 6137 | 6247 | 72705863 | 72705753 | 8.890000e-29 | 139.0 |
76 | TraesCS4B01G024100 | chr7A | 96.610 | 118 | 3 | 1 | 6010 | 6127 | 501070664 | 501070780 | 1.870000e-45 | 195.0 |
77 | TraesCS4B01G024100 | chr7A | 90.426 | 94 | 8 | 1 | 3537 | 3629 | 597530132 | 597530225 | 8.950000e-24 | 122.0 |
78 | TraesCS4B01G024100 | chr6A | 84.500 | 200 | 23 | 4 | 3628 | 3821 | 6860169 | 6859972 | 2.420000e-44 | 191.0 |
79 | TraesCS4B01G024100 | chr6A | 89.655 | 87 | 8 | 1 | 3465 | 3551 | 446759341 | 446759426 | 6.970000e-20 | 110.0 |
80 | TraesCS4B01G024100 | chr6A | 91.304 | 46 | 3 | 1 | 3513 | 3557 | 519206450 | 519206405 | 1.980000e-05 | 62.1 |
81 | TraesCS4B01G024100 | chr5B | 87.143 | 140 | 12 | 5 | 3560 | 3697 | 710617870 | 710618005 | 3.180000e-33 | 154.0 |
82 | TraesCS4B01G024100 | chr5B | 90.000 | 110 | 11 | 0 | 6137 | 6246 | 566119878 | 566119987 | 6.870000e-30 | 143.0 |
83 | TraesCS4B01G024100 | chr5B | 95.652 | 69 | 3 | 0 | 3819 | 3887 | 485658441 | 485658509 | 1.940000e-20 | 111.0 |
84 | TraesCS4B01G024100 | chr5B | 96.923 | 65 | 1 | 1 | 3819 | 3883 | 226429742 | 226429679 | 2.510000e-19 | 108.0 |
85 | TraesCS4B01G024100 | chr2D | 95.062 | 81 | 3 | 1 | 3550 | 3629 | 83539725 | 83539645 | 6.920000e-25 | 126.0 |
86 | TraesCS4B01G024100 | chr2D | 95.000 | 80 | 3 | 1 | 3551 | 3629 | 502931425 | 502931346 | 2.490000e-24 | 124.0 |
87 | TraesCS4B01G024100 | chr2D | 96.923 | 65 | 2 | 0 | 3819 | 3883 | 130082128 | 130082064 | 6.970000e-20 | 110.0 |
88 | TraesCS4B01G024100 | chr2D | 93.182 | 44 | 3 | 0 | 3506 | 3549 | 459811648 | 459811691 | 1.530000e-06 | 65.8 |
89 | TraesCS4B01G024100 | chr6D | 98.413 | 63 | 1 | 0 | 3819 | 3881 | 428405899 | 428405837 | 1.940000e-20 | 111.0 |
90 | TraesCS4B01G024100 | chr6D | 92.857 | 70 | 3 | 2 | 3819 | 3887 | 435990577 | 435990645 | 4.200000e-17 | 100.0 |
91 | TraesCS4B01G024100 | chrUn | 96.774 | 62 | 2 | 0 | 3819 | 3880 | 79579731 | 79579670 | 3.240000e-18 | 104.0 |
92 | TraesCS4B01G024100 | chrUn | 96.721 | 61 | 2 | 0 | 3819 | 3879 | 74542202 | 74542262 | 1.170000e-17 | 102.0 |
93 | TraesCS4B01G024100 | chrUn | 92.857 | 70 | 5 | 0 | 3819 | 3888 | 87983191 | 87983122 | 1.170000e-17 | 102.0 |
94 | TraesCS4B01G024100 | chrUn | 95.161 | 62 | 3 | 0 | 3819 | 3880 | 64149768 | 64149829 | 1.510000e-16 | 99.0 |
95 | TraesCS4B01G024100 | chrUn | 95.161 | 62 | 3 | 0 | 3819 | 3880 | 66416469 | 66416408 | 1.510000e-16 | 99.0 |
96 | TraesCS4B01G024100 | chrUn | 93.846 | 65 | 4 | 0 | 3819 | 3883 | 297895143 | 297895207 | 1.510000e-16 | 99.0 |
97 | TraesCS4B01G024100 | chrUn | 93.846 | 65 | 3 | 1 | 3819 | 3883 | 308283087 | 308283150 | 5.430000e-16 | 97.1 |
98 | TraesCS4B01G024100 | chrUn | 93.846 | 65 | 3 | 1 | 3819 | 3883 | 361187642 | 361187705 | 5.430000e-16 | 97.1 |
99 | TraesCS4B01G024100 | chr1D | 96.774 | 62 | 2 | 0 | 3819 | 3880 | 73688135 | 73688196 | 3.240000e-18 | 104.0 |
100 | TraesCS4B01G024100 | chr1D | 96.774 | 62 | 2 | 0 | 3819 | 3880 | 79014782 | 79014843 | 3.240000e-18 | 104.0 |
101 | TraesCS4B01G024100 | chr1D | 96.774 | 62 | 2 | 0 | 3819 | 3880 | 158107713 | 158107774 | 3.240000e-18 | 104.0 |
102 | TraesCS4B01G024100 | chr1D | 84.091 | 88 | 5 | 5 | 3464 | 3551 | 449233881 | 449233803 | 7.070000e-10 | 76.8 |
103 | TraesCS4B01G024100 | chr5A | 86.047 | 86 | 12 | 0 | 3465 | 3550 | 606181581 | 606181666 | 7.020000e-15 | 93.5 |
104 | TraesCS4B01G024100 | chr7D | 95.122 | 41 | 2 | 0 | 3510 | 3550 | 452448415 | 452448455 | 1.530000e-06 | 65.8 |
These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.
query | scaffold | start | end | length | rev.comp | avg.bitscore | max.bitscore | avg.percent.identical | query.start | query.end | num_hsp | groupid | homo_length | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | TraesCS4B01G024100 | chr4B | 17252638 | 17259213 | 6575 | False | 3774.333333 | 10689 | 98.947333 | 1 | 6576 | 3 | chr4B.!!$F4 | 6575 |
1 | TraesCS4B01G024100 | chr4B | 17268943 | 17270446 | 1503 | False | 385.000000 | 606 | 86.258000 | 3009 | 5190 | 4 | chr4B.!!$F5 | 2181 |
2 | TraesCS4B01G024100 | chr4A | 594161579 | 594167625 | 6046 | True | 1413.000000 | 3531 | 92.741200 | 3 | 6557 | 5 | chr4A.!!$R5 | 6554 |
3 | TraesCS4B01G024100 | chr4A | 594151259 | 594152258 | 999 | True | 264.000000 | 422 | 87.797667 | 3009 | 4694 | 3 | chr4A.!!$R4 | 1685 |
4 | TraesCS4B01G024100 | chr4D | 9247824 | 9253517 | 5693 | False | 1114.000000 | 2833 | 89.107500 | 1 | 6551 | 6 | chr4D.!!$F3 | 6550 |
5 | TraesCS4B01G024100 | chr4D | 28237046 | 28237798 | 752 | False | 490.000000 | 490 | 79.085000 | 2238 | 2975 | 1 | chr4D.!!$F1 | 737 |
6 | TraesCS4B01G024100 | chr4D | 9262727 | 9264160 | 1433 | False | 307.000000 | 436 | 88.133800 | 3009 | 5194 | 5 | chr4D.!!$F4 | 2185 |
AutoCloner calculated primer pairsThese primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible. |
---|
Position | MSA Position | Penalty | Sequence | TM | GC | Self any TH | Self end TH | Hairpin | End Stability | Orientation |
---|---|---|---|---|---|---|---|---|---|---|
849 | 863 | 0.388778 | TCAATCGTTAGCGCCGTGAA | 60.389 | 50.0 | 2.29 | 0.00 | 38.14 | 3.18 | F |
1437 | 1461 | 0.099968 | TACAGCTGCGACGTGGTATC | 59.900 | 55.0 | 15.27 | 0.00 | 0.00 | 2.24 | F |
2723 | 2766 | 0.107703 | TTATCTTGACTGCTGCGGGG | 60.108 | 55.0 | 13.87 | 0.00 | 0.00 | 5.73 | F |
3712 | 3792 | 0.038744 | AGTACTCCCTCCGTCCGAAA | 59.961 | 55.0 | 0.00 | 0.00 | 0.00 | 3.46 | F |
3818 | 3898 | 0.032813 | AGTATTTCCGGACGGAGGGA | 60.033 | 55.0 | 13.64 | 4.95 | 46.06 | 4.20 | F |
5465 | 5584 | 0.116940 | ATTGAACCCTGGCCACCATT | 59.883 | 50.0 | 0.00 | 0.00 | 30.82 | 3.16 | F |
Position | MSA Position | Penalty | Sequence | TM | GC | Self any TH | Self end TH | Hairpin | End Stability | Orientation |
---|---|---|---|---|---|---|---|---|---|---|
1783 | 1807 | 0.767375 | AGTGCAGAGGAGAAAAGCCA | 59.233 | 50.000 | 0.00 | 0.0 | 0.00 | 4.75 | R |
3192 | 3264 | 1.001746 | CTTCTTCCAGAGTCTGCAGCA | 59.998 | 52.381 | 15.10 | 0.0 | 0.00 | 4.41 | R |
3799 | 3879 | 0.032813 | TCCCTCCGTCCGGAAATACT | 60.033 | 55.000 | 5.23 | 0.0 | 44.66 | 2.12 | R |
5101 | 5220 | 0.099968 | CATCGCATGCTTCCTTGTGG | 59.900 | 55.000 | 17.13 | 0.0 | 0.00 | 4.17 | R |
5478 | 5597 | 0.238817 | TGGCGCAACAAACCGTTATC | 59.761 | 50.000 | 10.83 | 0.0 | 35.52 | 1.75 | R |
6448 | 6760 | 0.979187 | GAACCCTGACCCGATACCCA | 60.979 | 60.000 | 0.00 | 0.0 | 0.00 | 4.51 | R |
All possible primersListed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives. |
---|

Based at the University of Bristol with support from BBSRC.
AutoCloner maintained by Alex Coulton.