Multiple sequence alignment - TraesCS4B01G020800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G020800 chr4B 100.000 2663 0 0 1 2663 14709395 14712057 0 4918
1 TraesCS4B01G020800 chr2B 98.688 2667 30 5 1 2662 608457624 608460290 0 4726
2 TraesCS4B01G020800 chr2B 98.388 2667 37 5 2 2662 99567815 99565149 0 4682
3 TraesCS4B01G020800 chr2A 98.577 2670 30 8 1 2662 389206954 389209623 0 4713
4 TraesCS4B01G020800 chr6A 98.387 2666 39 3 1 2662 87943545 87940880 0 4682
5 TraesCS4B01G020800 chr6A 98.313 2667 40 5 1 2662 12690992 12693658 0 4671
6 TraesCS4B01G020800 chr5A 98.387 2666 39 4 1 2662 294236753 294234088 0 4682
7 TraesCS4B01G020800 chr5A 98.347 2662 39 4 6 2662 17467852 17465191 0 4667
8 TraesCS4B01G020800 chr1A 98.315 2670 37 7 1 2662 255473996 255471327 0 4674
9 TraesCS4B01G020800 chr7B 98.276 2668 40 5 1 2662 194130141 194127474 0 4667


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G020800 chr4B 14709395 14712057 2662 False 4918 4918 100.000 1 2663 1 chr4B.!!$F1 2662
1 TraesCS4B01G020800 chr2B 608457624 608460290 2666 False 4726 4726 98.688 1 2662 1 chr2B.!!$F1 2661
2 TraesCS4B01G020800 chr2B 99565149 99567815 2666 True 4682 4682 98.388 2 2662 1 chr2B.!!$R1 2660
3 TraesCS4B01G020800 chr2A 389206954 389209623 2669 False 4713 4713 98.577 1 2662 1 chr2A.!!$F1 2661
4 TraesCS4B01G020800 chr6A 87940880 87943545 2665 True 4682 4682 98.387 1 2662 1 chr6A.!!$R1 2661
5 TraesCS4B01G020800 chr6A 12690992 12693658 2666 False 4671 4671 98.313 1 2662 1 chr6A.!!$F1 2661
6 TraesCS4B01G020800 chr5A 294234088 294236753 2665 True 4682 4682 98.387 1 2662 1 chr5A.!!$R2 2661
7 TraesCS4B01G020800 chr5A 17465191 17467852 2661 True 4667 4667 98.347 6 2662 1 chr5A.!!$R1 2656
8 TraesCS4B01G020800 chr1A 255471327 255473996 2669 True 4674 4674 98.315 1 2662 1 chr1A.!!$R1 2661
9 TraesCS4B01G020800 chr7B 194127474 194130141 2667 True 4667 4667 98.276 1 2662 1 chr7B.!!$R1 2661

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
416 417 0.460987 GAGATCGGCCACCTGAACAG 60.461 60.0 2.24 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1878 1887 5.948162 ACTTTTGTTGATACATCAGGAGCAT 59.052 36.0 0.0 0.0 38.19 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.074775 CTTGGTGCAGGCAAGGGTA 59.925 57.895 0.00 0.00 0.00 3.69
171 172 0.555769 AGGTGTTCACCCATGTTGGT 59.444 50.000 17.06 0.00 39.96 3.67
361 362 1.537202 GTGGTTCTGATCCAGCACAAC 59.463 52.381 7.70 0.00 35.49 3.32
383 384 8.098220 CAACCTATTGTATACAAGCATATGCA 57.902 34.615 28.62 9.21 45.16 3.96
416 417 0.460987 GAGATCGGCCACCTGAACAG 60.461 60.000 2.24 0.00 0.00 3.16
945 947 2.147150 TGCGCATGCTGTGTTAGTTTA 58.853 42.857 17.13 0.00 43.34 2.01
1758 1764 6.057533 CCAAGTGGACAATTCAGCATCTATA 58.942 40.000 0.00 0.00 37.39 1.31
1835 1844 5.782893 AGTTGCTATTTGTGCCTTTGTTA 57.217 34.783 0.00 0.00 0.00 2.41
2627 2644 1.160137 GAGGCGTTGTTCATCAGCTT 58.840 50.000 0.00 0.00 0.00 3.74
2662 2679 4.245660 CGTCCTGCTTGAATCAAGAACTA 58.754 43.478 25.54 8.06 43.42 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 3.008594 ACCTTTCCGGTATGACATCAACA 59.991 43.478 0.00 0.0 46.73 3.33
694 696 9.435688 GGTTGACATCACATATATGCATAACTA 57.564 33.333 11.13 0.0 0.00 2.24
1758 1764 9.804977 AGCAGCATAAATTAGATAAGAGGAATT 57.195 29.630 0.00 0.0 0.00 2.17
1878 1887 5.948162 ACTTTTGTTGATACATCAGGAGCAT 59.052 36.000 0.00 0.0 38.19 3.79
2627 2644 1.943968 GCAGGACGCTGGACAACATTA 60.944 52.381 0.00 0.0 37.77 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.