Multiple sequence alignment - TraesCS4B01G010800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G010800 chr4B 100.000 4555 0 0 1 4555 7216596 7221150 0.000000e+00 8412.0
1 TraesCS4B01G010800 chr4B 99.277 4562 21 6 1 4555 7169637 7174193 0.000000e+00 8231.0
2 TraesCS4B01G010800 chr4B 97.761 4467 79 12 100 4555 7262311 7266767 0.000000e+00 7675.0
3 TraesCS4B01G010800 chr4B 98.648 4069 43 6 492 4555 7308198 7312259 0.000000e+00 7199.0
4 TraesCS4B01G010800 chr4B 94.696 4412 148 33 100 4490 7352756 7357102 0.000000e+00 6772.0
5 TraesCS4B01G010800 chr4B 79.585 965 129 32 826 1744 7381436 7382378 2.990000e-176 628.0
6 TraesCS4B01G010800 chr4B 98.675 302 4 0 1 302 7307897 7308198 1.860000e-148 536.0
7 TraesCS4B01G010800 chr4B 88.596 342 33 5 3416 3752 7378265 7378605 1.180000e-110 411.0
8 TraesCS4B01G010800 chr4B 84.776 335 39 8 323 647 415342363 415342695 4.390000e-85 326.0
9 TraesCS4B01G010800 chr4B 100.000 98 0 0 1 98 7165261 7165358 1.010000e-41 182.0
10 TraesCS4B01G010800 chr4B 98.980 98 1 0 1 98 7303523 7303620 4.680000e-40 176.0
11 TraesCS4B01G010800 chr4B 84.211 190 17 7 100 276 415342163 415342352 6.060000e-39 172.0
12 TraesCS4B01G010800 chr4B 97.959 98 1 1 1 98 7212224 7212320 7.840000e-38 169.0
13 TraesCS4B01G010800 chr4B 91.667 108 9 0 327 434 7308193 7308300 2.840000e-32 150.0
14 TraesCS4B01G010800 chr4D 91.321 3883 269 30 693 4552 4416851 4420688 0.000000e+00 5241.0
15 TraesCS4B01G010800 chr4A 90.464 3534 242 35 693 4206 599102598 599099140 0.000000e+00 4571.0
16 TraesCS4B01G010800 chr4A 90.382 3535 244 36 693 4206 599179977 599176518 0.000000e+00 4556.0
17 TraesCS4B01G010800 chr4A 90.351 3534 246 36 693 4206 599223404 599219946 0.000000e+00 4549.0
18 TraesCS4B01G010800 chr4A 90.560 3178 245 21 1066 4213 598960634 598957482 0.000000e+00 4156.0
19 TraesCS4B01G010800 chr4A 90.500 3179 241 24 1066 4213 598910263 598907115 0.000000e+00 4141.0
20 TraesCS4B01G010800 chr4A 90.836 2106 131 25 2110 4206 599246791 599244739 0.000000e+00 2763.0
21 TraesCS4B01G010800 chr4A 90.608 1629 117 17 693 2304 599084875 599083266 0.000000e+00 2128.0
22 TraesCS4B01G010800 chrUn 90.788 2106 132 25 2110 4206 216674910 216672858 0.000000e+00 2758.0
23 TraesCS4B01G010800 chrUn 90.174 1608 119 17 693 2282 360633214 360631628 0.000000e+00 2058.0
24 TraesCS4B01G010800 chrUn 88.846 520 40 6 693 1207 216652285 216651779 1.390000e-174 623.0
25 TraesCS4B01G010800 chr6A 90.177 733 51 5 3475 4206 593024590 593023878 0.000000e+00 935.0
26 TraesCS4B01G010800 chr3A 84.183 569 56 22 100 643 691379908 691379349 5.220000e-144 521.0
27 TraesCS4B01G010800 chr3A 86.008 243 26 5 194 431 683200399 683200638 2.100000e-63 254.0
28 TraesCS4B01G010800 chr3A 95.000 100 4 1 1 99 61453120 61453021 6.100000e-34 156.0
29 TraesCS4B01G010800 chr3B 87.065 201 23 2 444 641 154038896 154038696 1.650000e-54 224.0
30 TraesCS4B01G010800 chr3B 88.506 174 17 3 467 640 685579335 685579165 1.660000e-49 207.0
31 TraesCS4B01G010800 chr3B 84.091 88 10 4 444 527 154039005 154038918 1.050000e-11 82.4
32 TraesCS4B01G010800 chr1B 97.980 99 1 1 1 98 100317257 100317159 2.180000e-38 171.0
33 TraesCS4B01G010800 chr1B 96.117 103 2 2 1 101 100312765 100312663 2.820000e-37 167.0
34 TraesCS4B01G010800 chr7A 95.876 97 4 0 3 99 214908202 214908298 1.700000e-34 158.0
35 TraesCS4B01G010800 chr2B 100.000 46 0 0 584 629 179261021 179261066 8.120000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G010800 chr4B 7216596 7221150 4554 False 8412.000000 8412 100.0000 1 4555 1 chr4B.!!$F4 4554
1 TraesCS4B01G010800 chr4B 7169637 7174193 4556 False 8231.000000 8231 99.2770 1 4555 1 chr4B.!!$F2 4554
2 TraesCS4B01G010800 chr4B 7262311 7266767 4456 False 7675.000000 7675 97.7610 100 4555 1 chr4B.!!$F5 4455
3 TraesCS4B01G010800 chr4B 7352756 7357102 4346 False 6772.000000 6772 94.6960 100 4490 1 chr4B.!!$F7 4390
4 TraesCS4B01G010800 chr4B 7307897 7312259 4362 False 2628.333333 7199 96.3300 1 4555 3 chr4B.!!$F8 4554
5 TraesCS4B01G010800 chr4B 7378265 7382378 4113 False 519.500000 628 84.0905 826 3752 2 chr4B.!!$F9 2926
6 TraesCS4B01G010800 chr4B 415342163 415342695 532 False 249.000000 326 84.4935 100 647 2 chr4B.!!$F10 547
7 TraesCS4B01G010800 chr4D 4416851 4420688 3837 False 5241.000000 5241 91.3210 693 4552 1 chr4D.!!$F1 3859
8 TraesCS4B01G010800 chr4A 599099140 599102598 3458 True 4571.000000 4571 90.4640 693 4206 1 chr4A.!!$R4 3513
9 TraesCS4B01G010800 chr4A 599176518 599179977 3459 True 4556.000000 4556 90.3820 693 4206 1 chr4A.!!$R5 3513
10 TraesCS4B01G010800 chr4A 599219946 599223404 3458 True 4549.000000 4549 90.3510 693 4206 1 chr4A.!!$R6 3513
11 TraesCS4B01G010800 chr4A 598957482 598960634 3152 True 4156.000000 4156 90.5600 1066 4213 1 chr4A.!!$R2 3147
12 TraesCS4B01G010800 chr4A 598907115 598910263 3148 True 4141.000000 4141 90.5000 1066 4213 1 chr4A.!!$R1 3147
13 TraesCS4B01G010800 chr4A 599244739 599246791 2052 True 2763.000000 2763 90.8360 2110 4206 1 chr4A.!!$R7 2096
14 TraesCS4B01G010800 chr4A 599083266 599084875 1609 True 2128.000000 2128 90.6080 693 2304 1 chr4A.!!$R3 1611
15 TraesCS4B01G010800 chrUn 216672858 216674910 2052 True 2758.000000 2758 90.7880 2110 4206 1 chrUn.!!$R2 2096
16 TraesCS4B01G010800 chrUn 360631628 360633214 1586 True 2058.000000 2058 90.1740 693 2282 1 chrUn.!!$R3 1589
17 TraesCS4B01G010800 chrUn 216651779 216652285 506 True 623.000000 623 88.8460 693 1207 1 chrUn.!!$R1 514
18 TraesCS4B01G010800 chr6A 593023878 593024590 712 True 935.000000 935 90.1770 3475 4206 1 chr6A.!!$R1 731
19 TraesCS4B01G010800 chr3A 691379349 691379908 559 True 521.000000 521 84.1830 100 643 1 chr3A.!!$R2 543

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
839 845 2.864882 GCCGACAACACAGTACAGCTAA 60.865 50.0 0.0 0.0 0.00 3.09 F
2453 2525 0.887933 GGAAATGGCTCCTTGCGAAA 59.112 50.0 0.0 0.0 44.05 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2761 2834 5.464057 TGCAGATGAAGTGAAAAAGCAAATG 59.536 36.0 0.00 0.0 0.00 2.32 R
4287 4435 2.433604 CAGGTGAGATCAGCCACTACAT 59.566 50.0 8.34 0.0 44.82 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 6.951256 GGCAACAATTCCTAAATCTTTCAC 57.049 37.500 0.0 0.0 0.00 3.18
839 845 2.864882 GCCGACAACACAGTACAGCTAA 60.865 50.000 0.0 0.0 0.00 3.09
966 977 4.803426 CCGTCTCCACCGCTCAGC 62.803 72.222 0.0 0.0 0.00 4.26
2449 2521 2.936202 TGATAGGAAATGGCTCCTTGC 58.064 47.619 0.0 0.0 43.76 4.01
2453 2525 0.887933 GGAAATGGCTCCTTGCGAAA 59.112 50.000 0.0 0.0 44.05 3.46
2454 2526 1.478105 GGAAATGGCTCCTTGCGAAAT 59.522 47.619 0.0 0.0 44.05 2.17
3026 3100 1.960689 TCAGGTGTCTCGTGTCATTGA 59.039 47.619 0.0 0.0 34.10 2.57
3752 3865 3.006940 ACTGTTGTCGTGTGTTGATGTT 58.993 40.909 0.0 0.0 0.00 2.71
3770 3915 9.378551 GTTGATGTTAGTGTGAAGTCCATATTA 57.621 33.333 0.0 0.0 0.00 0.98
4287 4435 1.071542 TGGCCATCTTCGTCTTTGTCA 59.928 47.619 0.0 0.0 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 5.521735 CCTTCCACTCGAGTTTTGATATCTG 59.478 44.000 17.26 0.0 0.00 2.90
309 310 4.022589 CACAGGTACGTCTCCTTACAAGAA 60.023 45.833 9.14 0.0 32.37 2.52
310 311 3.504906 CACAGGTACGTCTCCTTACAAGA 59.495 47.826 9.14 0.0 32.37 3.02
2449 2521 8.592155 TGAGACGTCAACTCAATAATAATTTCG 58.408 33.333 19.50 0.0 40.70 3.46
2453 2525 9.436957 AAACTGAGACGTCAACTCAATAATAAT 57.563 29.630 19.50 0.0 42.58 1.28
2454 2526 8.827177 AAACTGAGACGTCAACTCAATAATAA 57.173 30.769 19.50 0.0 42.58 1.40
2761 2834 5.464057 TGCAGATGAAGTGAAAAAGCAAATG 59.536 36.000 0.00 0.0 0.00 2.32
3752 3865 9.642343 ACACTCTATAATATGGACTTCACACTA 57.358 33.333 0.00 0.0 0.00 2.74
3770 3915 3.368427 CCAACACATCCACGACACTCTAT 60.368 47.826 0.00 0.0 0.00 1.98
4287 4435 2.433604 CAGGTGAGATCAGCCACTACAT 59.566 50.000 8.34 0.0 44.82 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.