Multiple sequence alignment - TraesCS4B01G010700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G010700 chr4B 100.000 4553 0 0 1 4553 7169637 7174189 0.000000e+00 8408.0
1 TraesCS4B01G010700 chr4B 99.276 4558 21 6 1 4553 7216596 7221146 0.000000e+00 8224.0
2 TraesCS4B01G010700 chr4B 98.183 4459 72 7 99 4553 7262310 7266763 0.000000e+00 7777.0
3 TraesCS4B01G010700 chr4B 98.942 4064 37 2 490 4553 7308198 7312255 0.000000e+00 7262.0
4 TraesCS4B01G010700 chr4B 95.011 4410 142 27 99 4492 7352755 7357102 0.000000e+00 6854.0
5 TraesCS4B01G010700 chr4B 79.585 965 129 32 826 1744 7381436 7382378 2.990000e-176 628.0
6 TraesCS4B01G010700 chr4B 98.675 302 4 0 1 302 7307897 7308198 1.860000e-148 536.0
7 TraesCS4B01G010700 chr4B 88.921 343 32 5 3414 3751 7378265 7378606 7.040000e-113 418.0
8 TraesCS4B01G010700 chr4B 84.570 337 38 10 321 647 415342363 415342695 5.680000e-84 322.0
9 TraesCS4B01G010700 chr4B 98.980 98 1 0 1 98 7165261 7165358 4.680000e-40 176.0
10 TraesCS4B01G010700 chr4B 84.293 191 17 7 99 276 415342162 415342352 1.680000e-39 174.0
11 TraesCS4B01G010700 chr4B 97.959 98 2 0 1 98 7303523 7303620 2.180000e-38 171.0
12 TraesCS4B01G010700 chr4B 96.939 98 2 1 1 98 7212224 7212320 3.640000e-36 163.0
13 TraesCS4B01G010700 chr4B 91.667 108 9 0 325 432 7308193 7308300 2.840000e-32 150.0
14 TraesCS4B01G010700 chr4D 91.701 3880 260 25 693 4553 4416851 4420687 0.000000e+00 5325.0
15 TraesCS4B01G010700 chr4A 90.657 3532 237 33 693 4204 599102598 599099140 0.000000e+00 4608.0
16 TraesCS4B01G010700 chr4A 90.575 3533 239 34 693 4204 599179977 599176518 0.000000e+00 4593.0
17 TraesCS4B01G010700 chr4A 90.544 3532 241 34 693 4204 599223404 599219946 0.000000e+00 4586.0
18 TraesCS4B01G010700 chr4A 90.772 3175 242 20 1066 4211 598960634 598957482 0.000000e+00 4193.0
19 TraesCS4B01G010700 chr4A 90.775 3176 236 23 1066 4211 598910263 598907115 0.000000e+00 4189.0
20 TraesCS4B01G010700 chr4A 91.251 2103 126 20 2110 4204 599246791 599244739 0.000000e+00 2811.0
21 TraesCS4B01G010700 chr4A 90.669 1629 116 17 693 2304 599084875 599083266 0.000000e+00 2134.0
22 TraesCS4B01G010700 chrUn 91.251 2103 126 20 2110 4204 216674910 216672858 0.000000e+00 2811.0
23 TraesCS4B01G010700 chrUn 90.361 1608 116 17 693 2282 360633214 360631628 0.000000e+00 2074.0
24 TraesCS4B01G010700 chrUn 89.231 520 38 6 693 1207 216652285 216651779 6.430000e-178 634.0
25 TraesCS4B01G010700 chr6A 90.450 733 49 8 3473 4204 593024590 593023878 0.000000e+00 946.0
26 TraesCS4B01G010700 chr3A 84.520 562 57 20 99 635 691379909 691379353 3.120000e-146 529.0
27 TraesCS4B01G010700 chr3A 86.307 241 27 4 194 429 683200399 683200638 1.630000e-64 257.0
28 TraesCS4B01G010700 chr3B 87.065 201 20 3 442 636 154038896 154038696 5.930000e-54 222.0
29 TraesCS4B01G010700 chr3B 89.571 163 17 0 465 627 685579335 685579173 1.660000e-49 207.0
30 TraesCS4B01G010700 chr3B 84.091 88 10 4 442 525 154039005 154038918 1.050000e-11 82.4
31 TraesCS4B01G010700 chr1B 96.970 99 2 1 1 98 100317257 100317159 1.010000e-36 165.0
32 TraesCS4B01G010700 chr1B 95.960 99 3 1 1 98 100312765 100312667 4.710000e-35 159.0
33 TraesCS4B01G010700 chr5A 95.876 97 3 1 1 96 703344003 703344099 6.100000e-34 156.0
34 TraesCS4B01G010700 chr7A 94.792 96 5 0 3 98 214908202 214908297 2.840000e-32 150.0
35 TraesCS4B01G010700 chr2B 100.000 46 0 0 582 627 179261021 179261066 8.120000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G010700 chr4B 7169637 7174189 4552 False 8408.000000 8408 100.0000 1 4553 1 chr4B.!!$F2 4552
1 TraesCS4B01G010700 chr4B 7216596 7221146 4550 False 8224.000000 8224 99.2760 1 4553 1 chr4B.!!$F4 4552
2 TraesCS4B01G010700 chr4B 7262310 7266763 4453 False 7777.000000 7777 98.1830 99 4553 1 chr4B.!!$F5 4454
3 TraesCS4B01G010700 chr4B 7352755 7357102 4347 False 6854.000000 6854 95.0110 99 4492 1 chr4B.!!$F7 4393
4 TraesCS4B01G010700 chr4B 7307897 7312255 4358 False 2649.333333 7262 96.4280 1 4553 3 chr4B.!!$F8 4552
5 TraesCS4B01G010700 chr4B 7378265 7382378 4113 False 523.000000 628 84.2530 826 3751 2 chr4B.!!$F9 2925
6 TraesCS4B01G010700 chr4B 415342162 415342695 533 False 248.000000 322 84.4315 99 647 2 chr4B.!!$F10 548
7 TraesCS4B01G010700 chr4D 4416851 4420687 3836 False 5325.000000 5325 91.7010 693 4553 1 chr4D.!!$F1 3860
8 TraesCS4B01G010700 chr4A 599099140 599102598 3458 True 4608.000000 4608 90.6570 693 4204 1 chr4A.!!$R4 3511
9 TraesCS4B01G010700 chr4A 599176518 599179977 3459 True 4593.000000 4593 90.5750 693 4204 1 chr4A.!!$R5 3511
10 TraesCS4B01G010700 chr4A 599219946 599223404 3458 True 4586.000000 4586 90.5440 693 4204 1 chr4A.!!$R6 3511
11 TraesCS4B01G010700 chr4A 598957482 598960634 3152 True 4193.000000 4193 90.7720 1066 4211 1 chr4A.!!$R2 3145
12 TraesCS4B01G010700 chr4A 598907115 598910263 3148 True 4189.000000 4189 90.7750 1066 4211 1 chr4A.!!$R1 3145
13 TraesCS4B01G010700 chr4A 599244739 599246791 2052 True 2811.000000 2811 91.2510 2110 4204 1 chr4A.!!$R7 2094
14 TraesCS4B01G010700 chr4A 599083266 599084875 1609 True 2134.000000 2134 90.6690 693 2304 1 chr4A.!!$R3 1611
15 TraesCS4B01G010700 chrUn 216672858 216674910 2052 True 2811.000000 2811 91.2510 2110 4204 1 chrUn.!!$R2 2094
16 TraesCS4B01G010700 chrUn 360631628 360633214 1586 True 2074.000000 2074 90.3610 693 2282 1 chrUn.!!$R3 1589
17 TraesCS4B01G010700 chrUn 216651779 216652285 506 True 634.000000 634 89.2310 693 1207 1 chrUn.!!$R1 514
18 TraesCS4B01G010700 chr6A 593023878 593024590 712 True 946.000000 946 90.4500 3473 4204 1 chr6A.!!$R1 731
19 TraesCS4B01G010700 chr3A 691379353 691379909 556 True 529.000000 529 84.5200 99 635 1 chr3A.!!$R1 536

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
911 934 1.496060 TACAACATCCGCTCCTCCAT 58.504 50.0 0.0 0.0 0.00 3.41 F
2055 2128 2.270352 TGTCTGTTCTTCGGGCAATT 57.730 45.0 0.0 0.0 33.75 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2671 2760 4.772624 TGAGCTGTCAGGTTTACATAGAGT 59.227 41.667 5.91 0.0 0.0 3.24 R
4478 5459 3.128589 CGGGATCTAAATTTGGTGTGTGG 59.871 47.826 0.00 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 9.722317 TCCCATTTATGGTTAGGATTGTAAATT 57.278 29.630 7.92 0.0 46.65 1.82
911 934 1.496060 TACAACATCCGCTCCTCCAT 58.504 50.000 0.00 0.0 0.00 3.41
2008 2081 2.588464 TGGCGAGGGGAATTTTTGTA 57.412 45.000 0.00 0.0 0.00 2.41
2055 2128 2.270352 TGTCTGTTCTTCGGGCAATT 57.730 45.000 0.00 0.0 33.75 2.32
4475 5456 6.337356 TGGTTGGTTGATGAAAGAAAAACTC 58.663 36.000 0.00 0.0 0.00 3.01
4477 5458 7.340743 TGGTTGGTTGATGAAAGAAAAACTCTA 59.659 33.333 0.00 0.0 32.46 2.43
4478 5459 7.648112 GGTTGGTTGATGAAAGAAAAACTCTAC 59.352 37.037 0.00 0.0 32.46 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 9.571816 TTCCATTGCATGTCAATATATAGACAA 57.428 29.630 12.87 0.0 46.62 3.18
911 934 1.945354 GCGGAGTGAACGAGGATGGA 61.945 60.000 0.00 0.0 0.00 3.41
2055 2128 9.973661 TTTTCATTCTCAACCTAGAATAATGGA 57.026 29.630 0.00 0.0 42.90 3.41
2671 2760 4.772624 TGAGCTGTCAGGTTTACATAGAGT 59.227 41.667 5.91 0.0 0.00 3.24
4475 5456 5.357032 GGGATCTAAATTTGGTGTGTGGTAG 59.643 44.000 0.00 0.0 0.00 3.18
4477 5458 4.086457 GGGATCTAAATTTGGTGTGTGGT 58.914 43.478 0.00 0.0 0.00 4.16
4478 5459 3.128589 CGGGATCTAAATTTGGTGTGTGG 59.871 47.826 0.00 0.0 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.