Multiple sequence alignment - TraesCS4A01G492000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G492000 chr4A 100.000 2585 0 0 1 2585 741390103 741387519 0 4774
1 TraesCS4A01G492000 chr4A 98.608 2587 29 3 1 2585 741345767 741343186 0 4571
2 TraesCS4A01G492000 chr4A 97.951 2587 46 3 1 2585 741381917 741379336 0 4477
3 TraesCS4A01G492000 chr4A 97.640 2585 52 3 1 2585 741332669 741330094 0 4427
4 TraesCS4A01G492000 chr4A 97.410 2587 56 5 1 2585 741314642 741312065 0 4396
5 TraesCS4A01G492000 chrUn 98.067 2432 42 2 154 2585 290419353 290421779 0 4226
6 TraesCS4A01G492000 chrUn 98.067 2432 42 2 154 2585 324111372 324113798 0 4226
7 TraesCS4A01G492000 chrUn 98.414 1828 24 2 555 2382 51354847 51356669 0 3210
8 TraesCS4A01G492000 chrUn 94.673 1652 80 4 2 1652 51370338 51371982 0 2556
9 TraesCS4A01G492000 chrUn 97.596 1040 25 0 1 1040 392800369 392799330 0 1783
10 TraesCS4A01G492000 chrUn 97.464 552 14 0 1 552 468379583 468380134 0 942
11 TraesCS4A01G492000 chr7D 94.281 2588 104 13 2 2585 3937735 3940282 0 3919
12 TraesCS4A01G492000 chr7D 95.171 1926 80 5 458 2382 3954422 3956335 0 3029


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G492000 chr4A 741387519 741390103 2584 True 4774 4774 100.000 1 2585 1 chr4A.!!$R5 2584
1 TraesCS4A01G492000 chr4A 741343186 741345767 2581 True 4571 4571 98.608 1 2585 1 chr4A.!!$R3 2584
2 TraesCS4A01G492000 chr4A 741379336 741381917 2581 True 4477 4477 97.951 1 2585 1 chr4A.!!$R4 2584
3 TraesCS4A01G492000 chr4A 741330094 741332669 2575 True 4427 4427 97.640 1 2585 1 chr4A.!!$R2 2584
4 TraesCS4A01G492000 chr4A 741312065 741314642 2577 True 4396 4396 97.410 1 2585 1 chr4A.!!$R1 2584
5 TraesCS4A01G492000 chrUn 290419353 290421779 2426 False 4226 4226 98.067 154 2585 1 chrUn.!!$F3 2431
6 TraesCS4A01G492000 chrUn 324111372 324113798 2426 False 4226 4226 98.067 154 2585 1 chrUn.!!$F4 2431
7 TraesCS4A01G492000 chrUn 51354847 51356669 1822 False 3210 3210 98.414 555 2382 1 chrUn.!!$F1 1827
8 TraesCS4A01G492000 chrUn 51370338 51371982 1644 False 2556 2556 94.673 2 1652 1 chrUn.!!$F2 1650
9 TraesCS4A01G492000 chrUn 392799330 392800369 1039 True 1783 1783 97.596 1 1040 1 chrUn.!!$R1 1039
10 TraesCS4A01G492000 chrUn 468379583 468380134 551 False 942 942 97.464 1 552 1 chrUn.!!$F5 551
11 TraesCS4A01G492000 chr7D 3937735 3940282 2547 False 3919 3919 94.281 2 2585 1 chr7D.!!$F1 2583
12 TraesCS4A01G492000 chr7D 3954422 3956335 1913 False 3029 3029 95.171 458 2382 1 chr7D.!!$F2 1924

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
531 533 8.212317 ACAGTTTTTGCTTAATGATTTTGCTT 57.788 26.923 4.33 0.0 0.0 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2311 2316 0.251916 TCATAGCAAAGTCCACCCGG 59.748 55.0 0.0 0.0 0.0 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
531 533 8.212317 ACAGTTTTTGCTTAATGATTTTGCTT 57.788 26.923 4.33 0.00 0.00 3.91
1671 1674 2.167693 GACATCATGTCCCGTCCAGTAA 59.832 50.000 6.50 0.00 41.37 2.24
2210 2215 2.280389 CCACGATCCATGGGCTCG 60.280 66.667 26.23 26.23 38.34 5.03
2311 2316 4.328983 TGTCGCTCGACTTTTCATAATTCC 59.671 41.667 20.92 0.00 44.80 3.01
2496 2503 2.515429 ACAAAGGTGGGGCATATGATCT 59.485 45.455 6.97 0.00 0.00 2.75
2497 2504 3.721575 ACAAAGGTGGGGCATATGATCTA 59.278 43.478 6.97 0.00 0.00 1.98
2498 2505 4.354987 ACAAAGGTGGGGCATATGATCTAT 59.645 41.667 6.97 0.00 0.00 1.98
2499 2506 5.551583 ACAAAGGTGGGGCATATGATCTATA 59.448 40.000 6.97 0.00 0.00 1.31
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
763 765 3.132925 GCACATGCACTGGTTTTGAAAT 58.867 40.909 0.0 0.0 41.59 2.17
1272 1275 9.466497 AAATATAATTCTTTGTGCTTGAGAGGA 57.534 29.630 0.0 0.0 0.00 3.71
2210 2215 2.412847 GCAAGGTAGTCATGCACGTTTC 60.413 50.000 0.0 0.0 39.81 2.78
2311 2316 0.251916 TCATAGCAAAGTCCACCCGG 59.748 55.000 0.0 0.0 0.00 5.73
2496 2503 8.421784 CAAGATTAAAGGGCCGCTAGATATATA 58.578 37.037 0.0 0.0 0.00 0.86
2497 2504 7.275920 CAAGATTAAAGGGCCGCTAGATATAT 58.724 38.462 0.0 0.0 0.00 0.86
2498 2505 6.351881 CCAAGATTAAAGGGCCGCTAGATATA 60.352 42.308 0.0 0.0 0.00 0.86
2499 2506 5.491982 CAAGATTAAAGGGCCGCTAGATAT 58.508 41.667 0.0 0.0 0.00 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.