Multiple sequence alignment - TraesCS4A01G491800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G491800 chr4A 100.000 2897 0 0 1 2897 741332737 741329841 0 5350
1 TraesCS4A01G491800 chr4A 97.729 2906 57 3 1 2897 741390171 741387266 0 4992
2 TraesCS4A01G491800 chr4A 97.623 2903 62 3 1 2897 741381985 741379084 0 4972
3 TraesCS4A01G491800 chr4A 97.313 2903 71 3 1 2897 741345835 741342934 0 4922
4 TraesCS4A01G491800 chr4A 96.934 2903 77 6 1 2897 741314710 741311814 0 4857
5 TraesCS4A01G491800 chrUn 95.833 2904 98 11 1 2897 51344222 51347109 0 4671
6 TraesCS4A01G491800 chrUn 97.649 2680 58 2 222 2897 290419353 290422031 0 4595
7 TraesCS4A01G491800 chrUn 97.649 2680 58 2 222 2897 324111372 324114050 0 4595
8 TraesCS4A01G491800 chrUn 97.538 1828 37 2 622 2445 51354846 51356669 0 3120
9 TraesCS4A01G491800 chrUn 97.202 1108 31 0 1 1108 392800437 392799330 0 1875
10 TraesCS4A01G491800 chrUn 99.677 620 2 0 1 620 468379515 468380134 0 1134
11 TraesCS4A01G491800 chr7D 94.389 2905 120 12 1 2897 3937666 3940535 0 4421
12 TraesCS4A01G491800 chr7D 95.636 1925 68 5 526 2445 3954422 3956335 0 3075


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G491800 chr4A 741329841 741332737 2896 True 5350 5350 100.000 1 2897 1 chr4A.!!$R2 2896
1 TraesCS4A01G491800 chr4A 741387266 741390171 2905 True 4992 4992 97.729 1 2897 1 chr4A.!!$R5 2896
2 TraesCS4A01G491800 chr4A 741379084 741381985 2901 True 4972 4972 97.623 1 2897 1 chr4A.!!$R4 2896
3 TraesCS4A01G491800 chr4A 741342934 741345835 2901 True 4922 4922 97.313 1 2897 1 chr4A.!!$R3 2896
4 TraesCS4A01G491800 chr4A 741311814 741314710 2896 True 4857 4857 96.934 1 2897 1 chr4A.!!$R1 2896
5 TraesCS4A01G491800 chrUn 51344222 51347109 2887 False 4671 4671 95.833 1 2897 1 chrUn.!!$F1 2896
6 TraesCS4A01G491800 chrUn 290419353 290422031 2678 False 4595 4595 97.649 222 2897 1 chrUn.!!$F3 2675
7 TraesCS4A01G491800 chrUn 324111372 324114050 2678 False 4595 4595 97.649 222 2897 1 chrUn.!!$F4 2675
8 TraesCS4A01G491800 chrUn 51354846 51356669 1823 False 3120 3120 97.538 622 2445 1 chrUn.!!$F2 1823
9 TraesCS4A01G491800 chrUn 392799330 392800437 1107 True 1875 1875 97.202 1 1108 1 chrUn.!!$R1 1107
10 TraesCS4A01G491800 chrUn 468379515 468380134 619 False 1134 1134 99.677 1 620 1 chrUn.!!$F5 619
11 TraesCS4A01G491800 chr7D 3937666 3940535 2869 False 4421 4421 94.389 1 2897 1 chr7D.!!$F1 2896
12 TraesCS4A01G491800 chr7D 3954422 3956335 1913 False 3075 3075 95.636 526 2445 1 chr7D.!!$F2 1919

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1124 1126 9.781633 ATGGTAGTAGTCATACTAGTTCTAGTG 57.218 37.037 19.04 6.87 43.55 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2522 2533 3.128068 CCTTTGTTGCGGGTAAGGAATAC 59.872 47.826 0.0 0.0 39.6 1.89 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1124 1126 9.781633 ATGGTAGTAGTCATACTAGTTCTAGTG 57.218 37.037 19.04 6.87 43.55 2.74
1360 1364 5.240183 TCTTCCTCTCAAGCACAAAGAATTG 59.760 40.000 0.00 0.00 42.46 2.32
2522 2533 7.895759 ACAAATCGGGGGATTTTATCAATATG 58.104 34.615 0.00 0.00 32.97 1.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
414 416 1.528824 CCTCGGCCATGTTCTCCAT 59.471 57.895 2.24 0.0 0.00 3.41
1124 1126 0.394565 CTACCTGGGCCTGCTGTATC 59.605 60.000 4.53 0.0 0.00 2.24
1337 1341 5.009410 ACAATTCTTTGTGCTTGAGAGGAAG 59.991 40.000 0.00 0.0 44.36 3.46
2522 2533 3.128068 CCTTTGTTGCGGGTAAGGAATAC 59.872 47.826 0.00 0.0 39.60 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.