Multiple sequence alignment - TraesCS4A01G491700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G491700 chr4A 100.000 2584 0 0 1 2584 741314642 741312059 0 4772
1 TraesCS4A01G491700 chr4A 98.493 2588 35 2 1 2584 741381917 741379330 0 4560
2 TraesCS4A01G491700 chr4A 98.223 2588 42 2 1 2584 741345767 741343180 0 4521
3 TraesCS4A01G491700 chr4A 97.416 2593 56 5 1 2584 741390103 741387513 0 4407
4 TraesCS4A01G491700 chr4A 96.909 2588 70 4 1 2584 741332669 741330088 0 4327
5 TraesCS4A01G491700 chrUn 99.014 2435 18 3 154 2584 290419353 290421785 0 4359
6 TraesCS4A01G491700 chrUn 99.014 2435 18 3 154 2584 324111372 324113804 0 4359
7 TraesCS4A01G491700 chrUn 95.131 2588 106 10 2 2584 51344291 51346863 0 4063
8 TraesCS4A01G491700 chrUn 98.413 1827 21 4 555 2377 51354847 51356669 0 3206
9 TraesCS4A01G491700 chrUn 100.000 1040 0 0 1 1040 392800369 392799330 0 1921
10 TraesCS4A01G491700 chrUn 98.007 552 11 0 1 552 468379583 468380134 0 959
11 TraesCS4A01G491700 chr7D 93.938 2590 114 13 2 2584 3937735 3940288 0 3873
12 TraesCS4A01G491700 chr7D 94.751 1924 87 4 458 2377 3954422 3956335 0 2981


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G491700 chr4A 741312059 741314642 2583 True 4772 4772 100.000 1 2584 1 chr4A.!!$R1 2583
1 TraesCS4A01G491700 chr4A 741379330 741381917 2587 True 4560 4560 98.493 1 2584 1 chr4A.!!$R4 2583
2 TraesCS4A01G491700 chr4A 741343180 741345767 2587 True 4521 4521 98.223 1 2584 1 chr4A.!!$R3 2583
3 TraesCS4A01G491700 chr4A 741387513 741390103 2590 True 4407 4407 97.416 1 2584 1 chr4A.!!$R5 2583
4 TraesCS4A01G491700 chr4A 741330088 741332669 2581 True 4327 4327 96.909 1 2584 1 chr4A.!!$R2 2583
5 TraesCS4A01G491700 chrUn 290419353 290421785 2432 False 4359 4359 99.014 154 2584 1 chrUn.!!$F3 2430
6 TraesCS4A01G491700 chrUn 324111372 324113804 2432 False 4359 4359 99.014 154 2584 1 chrUn.!!$F4 2430
7 TraesCS4A01G491700 chrUn 51344291 51346863 2572 False 4063 4063 95.131 2 2584 1 chrUn.!!$F1 2582
8 TraesCS4A01G491700 chrUn 51354847 51356669 1822 False 3206 3206 98.413 555 2377 1 chrUn.!!$F2 1822
9 TraesCS4A01G491700 chrUn 392799330 392800369 1039 True 1921 1921 100.000 1 1040 1 chrUn.!!$R1 1039
10 TraesCS4A01G491700 chrUn 468379583 468380134 551 False 959 959 98.007 1 552 1 chrUn.!!$F5 551
11 TraesCS4A01G491700 chr7D 3937735 3940288 2553 False 3873 3873 93.938 2 2584 1 chr7D.!!$F1 2582
12 TraesCS4A01G491700 chr7D 3954422 3956335 1913 False 2981 2981 94.751 458 2377 1 chr7D.!!$F2 1919

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1040 1042 4.946478 AGAGTGTGATTATGGGAGTAGC 57.054 45.455 0.0 0.0 0.0 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2478 2487 4.261952 CGCTAGATAGATCATATGCCCCAG 60.262 50.0 0.0 0.0 0.0 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1040 1042 4.946478 AGAGTGTGATTATGGGAGTAGC 57.054 45.455 0.0 0.00 0.00 3.58
1499 1503 1.909376 CCGTCATCGTAGGTGAACAG 58.091 55.000 0.0 0.00 35.01 3.16
1731 1735 0.031917 TGTGATAGCTCCCGGGGTTA 60.032 55.000 23.5 14.12 0.00 2.85
2377 2386 0.036732 TGAGAGGCATTGGTGTGACC 59.963 55.000 0.0 0.00 39.22 4.02
2478 2487 0.955905 TTCCTTACCGGCAACAAAGC 59.044 50.000 0.0 0.00 0.00 3.51
2566 2579 8.934023 AAAAGAGAAAGGTGTGGACAATATTA 57.066 30.769 0.0 0.00 0.00 0.98
2571 2584 9.788960 GAGAAAGGTGTGGACAATATTAATTTC 57.211 33.333 0.0 0.00 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1499 1503 6.765036 TGCAATTCTCTATGACATCTTTCTCC 59.235 38.462 0.0 0.0 0.00 3.71
1731 1735 7.130442 ACCCTTACTGGAAATATATGGAAAGGT 59.870 37.037 0.0 0.0 38.35 3.50
2478 2487 4.261952 CGCTAGATAGATCATATGCCCCAG 60.262 50.000 0.0 0.0 0.00 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.