Multiple sequence alignment - TraesCS4A01G486800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G486800 chr4A 100.000 3653 0 0 1 3653 739679729 739683381 0.000000e+00 6746.0
1 TraesCS4A01G486800 chr4A 99.260 3647 19 3 1 3645 742073717 742077357 0.000000e+00 6578.0
2 TraesCS4A01G486800 chr4A 85.686 2564 290 42 628 3140 740604876 740602339 0.000000e+00 2630.0
3 TraesCS4A01G486800 chr4A 92.674 1829 120 9 679 2503 741780955 741779137 0.000000e+00 2623.0
4 TraesCS4A01G486800 chr4A 85.592 1978 260 17 876 2843 740156289 740158251 0.000000e+00 2050.0
5 TraesCS4A01G486800 chr4A 88.565 1679 169 10 1480 3140 740000020 739998347 0.000000e+00 2015.0
6 TraesCS4A01G486800 chr4A 87.274 1493 146 24 693 2170 741045121 741046584 0.000000e+00 1664.0
7 TraesCS4A01G486800 chr4A 87.981 1040 122 3 2003 3041 740157268 740158305 0.000000e+00 1225.0
8 TraesCS4A01G486800 chr4A 83.300 988 158 6 2003 2987 739999645 739998662 0.000000e+00 904.0
9 TraesCS4A01G486800 chr4A 84.197 791 99 13 2375 3143 741778833 741778047 0.000000e+00 745.0
10 TraesCS4A01G486800 chr4A 83.908 609 92 6 1555 2160 739740558 739741163 8.800000e-161 577.0
11 TraesCS4A01G486800 chr4A 81.353 665 109 14 1715 2372 741779780 741779124 8.980000e-146 527.0
12 TraesCS4A01G486800 chr4A 90.417 240 12 6 571 809 740000249 740000020 4.580000e-79 305.0
13 TraesCS4A01G486800 chr4A 90.789 152 9 1 525 676 741781348 741781202 8.000000e-47 198.0
14 TraesCS4A01G486800 chr4A 78.671 286 27 22 3382 3647 741777335 741777064 3.780000e-35 159.0
15 TraesCS4A01G486800 chr4A 80.460 174 24 1 3186 3359 739741740 739741903 1.380000e-24 124.0
16 TraesCS4A01G486800 chr4A 80.240 167 14 10 3451 3617 740159277 740159424 1.390000e-19 108.0
17 TraesCS4A01G486800 chr4A 89.333 75 4 3 3573 3645 739997752 739997680 1.400000e-14 91.6
18 TraesCS4A01G486800 chr4A 89.333 75 4 3 3573 3645 741047321 741047393 1.400000e-14 91.6
19 TraesCS4A01G486800 chr4A 100.000 34 0 0 521 554 740000280 740000247 3.050000e-06 63.9
20 TraesCS4A01G486800 chr4A 96.970 33 1 0 3482 3514 739684170 739684138 5.100000e-04 56.5
21 TraesCS4A01G486800 chr4A 96.970 33 1 0 3482 3514 742078152 742078120 5.100000e-04 56.5
22 TraesCS4A01G486800 chr7D 89.576 1650 116 16 521 2160 2885791 2884188 0.000000e+00 2043.0
23 TraesCS4A01G486800 chr7D 85.477 964 115 16 2183 3125 2883673 2882714 0.000000e+00 981.0
24 TraesCS4A01G486800 chr7D 89.610 77 4 3 3573 3647 2882112 2882038 1.080000e-15 95.3
25 TraesCS4A01G486800 chr7A 76.274 2394 488 54 692 3041 2742100 2744457 0.000000e+00 1201.0
26 TraesCS4A01G486800 chr7A 76.417 1976 417 33 868 2823 3029337 3031283 0.000000e+00 1022.0
27 TraesCS4A01G486800 chr7A 83.638 984 124 17 692 1652 2762871 2763840 0.000000e+00 891.0
28 TraesCS4A01G486800 chr7A 91.650 515 39 3 1 511 666559166 666558652 0.000000e+00 710.0
29 TraesCS4A01G486800 chr7A 78.160 989 209 7 1918 2903 2662890 2661906 1.110000e-174 623.0
30 TraesCS4A01G486800 chr7A 88.768 276 23 4 917 1191 2664255 2663987 7.560000e-87 331.0
31 TraesCS4A01G486800 chr7A 87.660 235 24 3 582 816 2605897 2605668 6.010000e-68 268.0
32 TraesCS4A01G486800 chr7A 87.624 202 23 2 562 762 2664492 2664292 2.190000e-57 233.0
33 TraesCS4A01G486800 chr7A 84.729 203 14 7 3186 3383 2660902 2660712 1.730000e-43 187.0
34 TraesCS4A01G486800 chr7A 89.831 118 12 0 582 699 2741953 2742070 6.320000e-33 152.0
35 TraesCS4A01G486800 chr7A 89.831 118 12 0 582 699 2762724 2762841 6.320000e-33 152.0
36 TraesCS4A01G486800 chr7A 80.412 194 17 7 3451 3644 3031859 3032031 1.060000e-25 128.0
37 TraesCS4A01G486800 chr7A 92.222 90 4 1 683 769 2939451 2939540 1.380000e-24 124.0
38 TraesCS4A01G486800 chr7A 78.462 195 18 10 3459 3647 2947065 2947241 4.990000e-19 106.0
39 TraesCS4A01G486800 chr7A 87.805 82 9 1 3459 3540 2547937 2548017 1.080000e-15 95.3
40 TraesCS4A01G486800 chr5B 98.848 521 5 1 1 520 657879608 657880128 0.000000e+00 928.0
41 TraesCS4A01G486800 chr5B 98.095 525 9 1 1 524 55543140 55543664 0.000000e+00 913.0
42 TraesCS4A01G486800 chr5B 92.829 516 31 5 1 511 84670014 84669500 0.000000e+00 743.0
43 TraesCS4A01G486800 chr3B 97.552 531 10 3 1 529 823010794 823010265 0.000000e+00 905.0
44 TraesCS4A01G486800 chr4B 97.714 525 8 2 1 521 515116931 515116407 0.000000e+00 900.0
45 TraesCS4A01G486800 chr6B 95.247 526 19 3 1 520 11726543 11727068 0.000000e+00 828.0
46 TraesCS4A01G486800 chr2A 91.810 525 36 5 1 520 312713852 312713330 0.000000e+00 725.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G486800 chr4A 739679729 739683381 3652 False 6746.000000 6746 100.000000 1 3653 1 chr4A.!!$F1 3652
1 TraesCS4A01G486800 chr4A 742073717 742077357 3640 False 6578.000000 6578 99.260000 1 3645 1 chr4A.!!$F2 3644
2 TraesCS4A01G486800 chr4A 740602339 740604876 2537 True 2630.000000 2630 85.686000 628 3140 1 chr4A.!!$R2 2512
3 TraesCS4A01G486800 chr4A 740156289 740159424 3135 False 1127.666667 2050 84.604333 876 3617 3 chr4A.!!$F4 2741
4 TraesCS4A01G486800 chr4A 741045121 741047393 2272 False 877.800000 1664 88.303500 693 3645 2 chr4A.!!$F5 2952
5 TraesCS4A01G486800 chr4A 741777064 741781348 4284 True 850.400000 2623 85.536800 525 3647 5 chr4A.!!$R5 3122
6 TraesCS4A01G486800 chr4A 739997680 740000280 2600 True 675.900000 2015 90.323000 521 3645 5 chr4A.!!$R4 3124
7 TraesCS4A01G486800 chr4A 739740558 739741903 1345 False 350.500000 577 82.184000 1555 3359 2 chr4A.!!$F3 1804
8 TraesCS4A01G486800 chr7D 2882038 2885791 3753 True 1039.766667 2043 88.221000 521 3647 3 chr7D.!!$R1 3126
9 TraesCS4A01G486800 chr7A 666558652 666559166 514 True 710.000000 710 91.650000 1 511 1 chr7A.!!$R2 510
10 TraesCS4A01G486800 chr7A 2741953 2744457 2504 False 676.500000 1201 83.052500 582 3041 2 chr7A.!!$F4 2459
11 TraesCS4A01G486800 chr7A 3029337 3032031 2694 False 575.000000 1022 78.414500 868 3644 2 chr7A.!!$F6 2776
12 TraesCS4A01G486800 chr7A 2762724 2763840 1116 False 521.500000 891 86.734500 582 1652 2 chr7A.!!$F5 1070
13 TraesCS4A01G486800 chr7A 2660712 2664492 3780 True 343.500000 623 84.820250 562 3383 4 chr7A.!!$R3 2821
14 TraesCS4A01G486800 chr5B 657879608 657880128 520 False 928.000000 928 98.848000 1 520 1 chr5B.!!$F2 519
15 TraesCS4A01G486800 chr5B 55543140 55543664 524 False 913.000000 913 98.095000 1 524 1 chr5B.!!$F1 523
16 TraesCS4A01G486800 chr5B 84669500 84670014 514 True 743.000000 743 92.829000 1 511 1 chr5B.!!$R1 510
17 TraesCS4A01G486800 chr3B 823010265 823010794 529 True 905.000000 905 97.552000 1 529 1 chr3B.!!$R1 528
18 TraesCS4A01G486800 chr4B 515116407 515116931 524 True 900.000000 900 97.714000 1 521 1 chr4B.!!$R1 520
19 TraesCS4A01G486800 chr6B 11726543 11727068 525 False 828.000000 828 95.247000 1 520 1 chr6B.!!$F1 519
20 TraesCS4A01G486800 chr2A 312713330 312713852 522 True 725.000000 725 91.810000 1 520 1 chr2A.!!$R1 519

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
41 42 3.244630 ACCAAAGCTCCGTGTTTATGGTA 60.245 43.478 0.0 0.0 38.11 3.25 F
200 204 5.014858 AGATCAAGTTGCAGATGGTTTCAT 58.985 37.500 0.0 0.0 36.09 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2540 5095 8.695456 ACAAGTCTATGAGTTTGGTCAAATTTT 58.305 29.63 0.0 0.0 32.36 1.82 R
3523 7683 0.449786 CCGTGCGCAATGGTTCATTA 59.550 50.00 14.0 0.0 32.35 1.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 3.244630 ACCAAAGCTCCGTGTTTATGGTA 60.245 43.478 0.00 0.0 38.11 3.25
200 204 5.014858 AGATCAAGTTGCAGATGGTTTCAT 58.985 37.500 0.00 0.0 36.09 2.57
1880 2646 6.419710 GGAAACAAACTTTCTGGGTTAATTCG 59.580 38.462 0.00 0.0 0.00 3.34
1940 2706 6.591935 TGAGTCTTGGTGAAAACATACTCTT 58.408 36.000 0.00 0.0 34.70 2.85
2540 5095 5.523588 TGGTTCCATCCCAAATAGCATAAA 58.476 37.500 0.00 0.0 0.00 1.40
3244 6674 2.257371 CACTCGTCCTCGCCGAAA 59.743 61.111 0.00 0.0 36.96 3.46
3245 6675 1.372499 CACTCGTCCTCGCCGAAAA 60.372 57.895 0.00 0.0 36.96 2.29
3509 7666 3.955471 TGAGATTGCCTAAAGTTCCCAG 58.045 45.455 0.00 0.0 0.00 4.45
3521 7681 7.351166 CCTAAAGTTCCCAGGGTATGAATTAA 58.649 38.462 5.01 0.0 0.00 1.40
3522 7682 8.004801 CCTAAAGTTCCCAGGGTATGAATTAAT 58.995 37.037 5.01 0.0 0.00 1.40
3523 7683 9.421399 CTAAAGTTCCCAGGGTATGAATTAATT 57.579 33.333 5.01 0.0 0.00 1.40
3647 7818 6.455360 TTTCCTGCCTGAATGTTTATCATC 57.545 37.500 0.00 0.0 35.48 2.92
3648 7819 4.464008 TCCTGCCTGAATGTTTATCATCC 58.536 43.478 0.00 0.0 35.48 3.51
3649 7820 4.166725 TCCTGCCTGAATGTTTATCATCCT 59.833 41.667 0.00 0.0 35.48 3.24
3650 7821 4.891756 CCTGCCTGAATGTTTATCATCCTT 59.108 41.667 0.00 0.0 35.48 3.36
3651 7822 6.064060 CCTGCCTGAATGTTTATCATCCTTA 58.936 40.000 0.00 0.0 35.48 2.69
3652 7823 6.016777 CCTGCCTGAATGTTTATCATCCTTAC 60.017 42.308 0.00 0.0 35.48 2.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 3.959495 AGGTGGCACCAAGATTATCAT 57.041 42.857 36.28 10.69 41.95 2.45
200 204 4.453751 ACTTCTTGTAGGCAACGGTTTTA 58.546 39.130 0.00 0.00 46.39 1.52
2540 5095 8.695456 ACAAGTCTATGAGTTTGGTCAAATTTT 58.305 29.630 0.00 0.00 32.36 1.82
3521 7681 2.479389 CCGTGCGCAATGGTTCATTAAT 60.479 45.455 14.00 0.00 32.35 1.40
3522 7682 1.135546 CCGTGCGCAATGGTTCATTAA 60.136 47.619 14.00 0.00 32.35 1.40
3523 7683 0.449786 CCGTGCGCAATGGTTCATTA 59.550 50.000 14.00 0.00 32.35 1.90
3524 7684 1.212490 CCGTGCGCAATGGTTCATT 59.788 52.632 14.00 0.00 34.04 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.