Multiple sequence alignment - TraesCS4A01G485200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G485200 chr4A 100.000 2786 0 0 1 2786 739023759 739020974 0 5145
1 TraesCS4A01G485200 chr4A 98.744 2786 34 1 1 2786 611655148 611657932 0 4950
2 TraesCS4A01G485200 chr4A 99.468 939 5 0 1 939 739015479 739014541 0 1707
3 TraesCS4A01G485200 chr1B 99.210 2786 22 0 1 2786 610379322 610382107 0 5024
4 TraesCS4A01G485200 chr1B 99.148 939 8 0 1 939 610387602 610388540 0 1690
5 TraesCS4A01G485200 chr6A 99.067 2786 25 1 1 2786 570352997 570355781 0 5000
6 TraesCS4A01G485200 chr6A 97.544 2809 40 3 1 2786 584410214 584413016 0 4778
7 TraesCS4A01G485200 chr6A 99.255 939 7 0 1 939 584418508 584419446 0 1696
8 TraesCS4A01G485200 chr7B 98.149 2809 27 3 1 2786 535642002 535644808 0 4876
9 TraesCS4A01G485200 chr2B 98.955 2296 24 0 491 2786 626032645 626034940 0 4108
10 TraesCS4A01G485200 chr2B 99.574 940 3 1 1 940 626040435 626041373 0 1712
11 TraesCS4A01G485200 chr6B 92.038 2826 138 30 1 2786 47737738 47734960 0 3892
12 TraesCS4A01G485200 chr6B 91.932 2826 141 29 1 2786 47698648 47695870 0 3875
13 TraesCS4A01G485200 chr6B 91.791 2826 143 30 1 2786 47658685 47655909 0 3851


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G485200 chr4A 739020974 739023759 2785 True 5145 5145 100.000 1 2786 1 chr4A.!!$R2 2785
1 TraesCS4A01G485200 chr4A 611655148 611657932 2784 False 4950 4950 98.744 1 2786 1 chr4A.!!$F1 2785
2 TraesCS4A01G485200 chr4A 739014541 739015479 938 True 1707 1707 99.468 1 939 1 chr4A.!!$R1 938
3 TraesCS4A01G485200 chr1B 610379322 610382107 2785 False 5024 5024 99.210 1 2786 1 chr1B.!!$F1 2785
4 TraesCS4A01G485200 chr1B 610387602 610388540 938 False 1690 1690 99.148 1 939 1 chr1B.!!$F2 938
5 TraesCS4A01G485200 chr6A 570352997 570355781 2784 False 5000 5000 99.067 1 2786 1 chr6A.!!$F1 2785
6 TraesCS4A01G485200 chr6A 584410214 584413016 2802 False 4778 4778 97.544 1 2786 1 chr6A.!!$F2 2785
7 TraesCS4A01G485200 chr6A 584418508 584419446 938 False 1696 1696 99.255 1 939 1 chr6A.!!$F3 938
8 TraesCS4A01G485200 chr7B 535642002 535644808 2806 False 4876 4876 98.149 1 2786 1 chr7B.!!$F1 2785
9 TraesCS4A01G485200 chr2B 626032645 626034940 2295 False 4108 4108 98.955 491 2786 1 chr2B.!!$F1 2295
10 TraesCS4A01G485200 chr2B 626040435 626041373 938 False 1712 1712 99.574 1 940 1 chr2B.!!$F2 939
11 TraesCS4A01G485200 chr6B 47734960 47737738 2778 True 3892 3892 92.038 1 2786 1 chr6B.!!$R3 2785
12 TraesCS4A01G485200 chr6B 47695870 47698648 2778 True 3875 3875 91.932 1 2786 1 chr6B.!!$R2 2785
13 TraesCS4A01G485200 chr6B 47655909 47658685 2776 True 3851 3851 91.791 1 2786 1 chr6B.!!$R1 2785

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
909 910 1.816863 AAGGACACGGCGACTGTCAT 61.817 55.0 25.5 19.08 39.05 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1934 1973 2.30418 AGACCATCCCAACACAGAGAAG 59.696 50.0 0.0 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
836 837 9.523168 AATTAAAGTATTACTTGTGCCCTGTTA 57.477 29.630 9.78 0.00 38.66 2.41
871 872 2.154462 ACTCATGCCTTGTGTGCTTAC 58.846 47.619 0.00 0.00 31.07 2.34
909 910 1.816863 AAGGACACGGCGACTGTCAT 61.817 55.000 25.50 19.08 39.05 3.06
949 950 2.484241 GGGTCGTGACAGTTTTAGTGGT 60.484 50.000 2.00 0.00 0.00 4.16
965 989 3.362706 AGTGGTATCAGAGCCTCGTTTA 58.637 45.455 0.00 0.00 0.00 2.01
1150 1177 2.383442 TGGAGTAGTCCTGGGATAGC 57.617 55.000 17.62 0.00 44.30 2.97
1378 1407 1.549170 GACAGGGTTCCTCACGTGTAT 59.451 52.381 16.51 0.00 36.03 2.29
1634 1663 2.093973 CGCCTCACTCACAGGTTCTATT 60.094 50.000 0.00 0.00 32.98 1.73
1699 1728 2.430367 GGTGGCGGAAGTTCCAGT 59.570 61.111 21.76 0.00 35.91 4.00
1855 1884 3.434319 CATGGCGTGAGGTGTGGC 61.434 66.667 0.00 0.00 0.00 5.01
1934 1973 4.994852 TGTGCTTGTAATGTAAGGACTGAC 59.005 41.667 10.02 0.00 43.98 3.51
1966 2005 1.133976 GGGATGGTCTAAGCATGCTGT 60.134 52.381 23.48 13.84 42.81 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
836 837 7.434927 AGGCATGAGTAGCATATATCAGAAT 57.565 36.000 0.0 0.0 34.82 2.40
871 872 5.346281 GTCCTTATGAGTTGAAGAACACTCG 59.654 44.000 0.0 0.0 34.17 4.18
1150 1177 6.795098 AAGAGAGACATCATAGCTACTACG 57.205 41.667 0.0 0.0 0.00 3.51
1699 1728 1.524393 CACTGCTCACACACTGCCA 60.524 57.895 0.0 0.0 0.00 4.92
1934 1973 2.304180 AGACCATCCCAACACAGAGAAG 59.696 50.000 0.0 0.0 0.00 2.85
2006 2046 4.437682 TCACCAGGATCAAACTTCAGTT 57.562 40.909 0.0 0.0 40.50 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.