Multiple sequence alignment - TraesCS4A01G473100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G473100 chr4A 100.000 2241 0 0 1 2241 733119772 733117532 0.000000e+00 4139
1 TraesCS4A01G473100 chr4A 98.885 2242 23 2 1 2241 733059959 733057719 0.000000e+00 4000
2 TraesCS4A01G473100 chr4A 99.097 1994 17 1 249 2241 733241721 733239728 0.000000e+00 3581
3 TraesCS4A01G473100 chr4A 85.277 1046 95 20 322 1337 732976521 732977537 0.000000e+00 1024
4 TraesCS4A01G473100 chr4A 84.687 751 55 18 330 1056 732975330 732976044 0.000000e+00 695
5 TraesCS4A01G473100 chr4A 97.573 206 5 0 1 206 733241925 733241720 9.850000e-94 353
6 TraesCS4A01G473100 chr4A 78.914 313 34 17 246 548 732480622 732480332 1.370000e-42 183
7 TraesCS4A01G473100 chr7D 87.284 1502 98 25 1 1442 6965700 6967168 0.000000e+00 1629
8 TraesCS4A01G473100 chr7D 84.691 1019 98 24 447 1423 7071852 7072854 0.000000e+00 965
9 TraesCS4A01G473100 chr7D 87.179 156 10 9 256 407 7071692 7071841 3.830000e-38 169
10 TraesCS4A01G473100 chr7D 77.152 302 37 15 257 548 7194739 7194460 1.790000e-31 147
11 TraesCS4A01G473100 chr7A 86.111 1080 98 20 386 1423 7912224 7913293 0.000000e+00 1116
12 TraesCS4A01G473100 chr7A 84.262 1220 106 40 256 1443 7907756 7908921 0.000000e+00 1110
13 TraesCS4A01G473100 chr7A 77.181 986 136 46 170 1122 8121460 8120531 2.000000e-135 492
14 TraesCS4A01G473100 chr7A 83.686 331 43 5 929 1252 7946617 7946291 3.620000e-78 302
15 TraesCS4A01G473100 chr7A 76.382 597 85 20 455 1013 7792039 7792617 1.020000e-68 270
16 TraesCS4A01G473100 chrUn 83.203 1149 107 35 330 1434 51206638 51205532 0.000000e+00 974
17 TraesCS4A01G473100 chrUn 100.000 412 0 0 197 608 477544538 477544127 0.000000e+00 761
18 TraesCS4A01G473100 chrUn 80.846 898 120 23 574 1434 51220879 51219997 0.000000e+00 658
19 TraesCS4A01G473100 chrUn 87.528 441 40 7 1443 1876 96036145 96036577 1.550000e-136 496
20 TraesCS4A01G473100 chrUn 83.420 193 20 8 246 432 34119040 34119226 3.830000e-38 169
21 TraesCS4A01G473100 chr6B 94.823 367 18 1 1876 2241 606042594 606042960 2.500000e-159 571
22 TraesCS4A01G473100 chr5B 94.385 374 13 2 1876 2241 708822192 708821819 3.230000e-158 568
23 TraesCS4A01G473100 chr5B 83.420 193 20 8 246 432 526876026 526875840 3.830000e-38 169
24 TraesCS4A01G473100 chr4B 94.293 368 19 2 1876 2241 664645858 664646225 1.500000e-156 562
25 TraesCS4A01G473100 chr4B 83.420 193 20 8 246 432 555285022 555285208 3.830000e-38 169
26 TraesCS4A01G473100 chr1B 93.867 375 15 2 1875 2241 575695667 575695293 1.940000e-155 558
27 TraesCS4A01G473100 chr1B 93.750 368 20 3 1876 2241 678830829 678830463 1.170000e-152 549
28 TraesCS4A01G473100 chr1B 88.235 442 38 8 1442 1876 496194430 496194864 1.190000e-142 516
29 TraesCS4A01G473100 chr2B 94.038 369 19 2 1876 2241 25925398 25925030 6.990000e-155 556
30 TraesCS4A01G473100 chr2B 93.514 370 21 2 1873 2241 756072428 756072795 4.210000e-152 547
31 TraesCS4A01G473100 chr4D 89.773 440 30 8 1444 1876 375142651 375143082 1.170000e-152 549
32 TraesCS4A01G473100 chr6A 87.528 441 41 6 1443 1876 277285177 277285610 4.300000e-137 497
33 TraesCS4A01G473100 chr7B 86.758 438 43 8 1446 1876 483018093 483017664 7.240000e-130 473
34 TraesCS4A01G473100 chr5D 86.652 442 42 9 1443 1876 371013032 371012600 7.240000e-130 473
35 TraesCS4A01G473100 chr5D 86.818 440 39 11 1444 1876 530410308 530410735 7.240000e-130 473


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G473100 chr4A 733117532 733119772 2240 True 4139.0 4139 100.0000 1 2241 1 chr4A.!!$R3 2240
1 TraesCS4A01G473100 chr4A 733057719 733059959 2240 True 4000.0 4000 98.8850 1 2241 1 chr4A.!!$R2 2240
2 TraesCS4A01G473100 chr4A 733239728 733241925 2197 True 1967.0 3581 98.3350 1 2241 2 chr4A.!!$R4 2240
3 TraesCS4A01G473100 chr4A 732975330 732977537 2207 False 859.5 1024 84.9820 322 1337 2 chr4A.!!$F1 1015
4 TraesCS4A01G473100 chr7D 6965700 6967168 1468 False 1629.0 1629 87.2840 1 1442 1 chr7D.!!$F1 1441
5 TraesCS4A01G473100 chr7D 7071692 7072854 1162 False 567.0 965 85.9350 256 1423 2 chr7D.!!$F2 1167
6 TraesCS4A01G473100 chr7A 7907756 7913293 5537 False 1113.0 1116 85.1865 256 1443 2 chr7A.!!$F2 1187
7 TraesCS4A01G473100 chr7A 8120531 8121460 929 True 492.0 492 77.1810 170 1122 1 chr7A.!!$R2 952
8 TraesCS4A01G473100 chr7A 7792039 7792617 578 False 270.0 270 76.3820 455 1013 1 chr7A.!!$F1 558
9 TraesCS4A01G473100 chrUn 51205532 51206638 1106 True 974.0 974 83.2030 330 1434 1 chrUn.!!$R1 1104
10 TraesCS4A01G473100 chrUn 51219997 51220879 882 True 658.0 658 80.8460 574 1434 1 chrUn.!!$R2 860

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
655 5064 2.336891 CTCTGGATCTGGGGACATCAT 58.663 52.381 0.0 0.0 41.51 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1714 7420 2.592993 CCTTCCTCCTTGTGCCGGA 61.593 63.158 5.05 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
623 5032 7.983307 ACTTAATCACAGATGCTTCTTCATTC 58.017 34.615 0.0 0.0 0.00 2.67
655 5064 2.336891 CTCTGGATCTGGGGACATCAT 58.663 52.381 0.0 0.0 41.51 2.45
1714 7420 3.710165 CCGGACTTATTCTAGGGTTTCCT 59.290 47.826 0.0 0.0 46.96 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 1.782028 AAACTGCTCGTTCGTTGCCC 61.782 55.000 9.27 0.00 33.90 5.36
623 5032 6.462500 CCCAGATCCAGAGTATTAATCTGTG 58.538 44.000 17.25 10.18 42.18 3.66
655 5064 2.819608 GCAGAGAATGGTTGCCAACTTA 59.180 45.455 7.62 0.00 36.95 2.24
1714 7420 2.592993 CCTTCCTCCTTGTGCCGGA 61.593 63.158 5.05 0.00 0.00 5.14
2026 7732 3.710722 CTCCTGCTTGGGCTCGGT 61.711 66.667 0.00 0.00 39.59 4.69
2036 7742 2.860971 ACCAAAGGCCCTCCTGCT 60.861 61.111 0.00 0.00 43.40 4.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.