Multiple sequence alignment - TraesCS4A01G455100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G455100 chr4A 100.000 2453 0 0 1 2453 718896601 718894149 0 4530
1 TraesCS4A01G455100 chr4A 99.143 2450 21 0 1 2450 718466586 718469035 0 4409
2 TraesCS4A01G455100 chr4A 94.578 498 27 0 201 698 718249897 718250394 0 771
3 TraesCS4A01G455100 chr7A 90.123 1458 142 2 1 1457 15253124 15251668 0 1893
4 TraesCS4A01G455100 chr7A 88.425 1486 157 5 1 1486 15274884 15273414 0 1777
5 TraesCS4A01G455100 chr7D 88.702 1487 161 5 1 1486 26382779 26381299 0 1808
6 TraesCS4A01G455100 chr7D 86.412 1494 192 9 1 1486 26448309 26446819 0 1624


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G455100 chr4A 718894149 718896601 2452 True 4530 4530 100.000 1 2453 1 chr4A.!!$R1 2452
1 TraesCS4A01G455100 chr4A 718466586 718469035 2449 False 4409 4409 99.143 1 2450 1 chr4A.!!$F2 2449
2 TraesCS4A01G455100 chr7A 15251668 15253124 1456 True 1893 1893 90.123 1 1457 1 chr7A.!!$R1 1456
3 TraesCS4A01G455100 chr7A 15273414 15274884 1470 True 1777 1777 88.425 1 1486 1 chr7A.!!$R2 1485
4 TraesCS4A01G455100 chr7D 26381299 26382779 1480 True 1808 1808 88.702 1 1486 1 chr7D.!!$R1 1485
5 TraesCS4A01G455100 chr7D 26446819 26448309 1490 True 1624 1624 86.412 1 1486 1 chr7D.!!$R2 1485

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
478 479 0.890996 AGTCTTTCAAAGCTGCCCCG 60.891 55.0 0.0 0.0 0.0 5.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2007 2014 2.426183 CGCCGAAGAACGTCGTCAG 61.426 63.158 0.0 0.0 38.54 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
404 405 3.535561 AGGATTCTAACTCAACCATGCG 58.464 45.455 0.00 0.00 0.00 4.73
478 479 0.890996 AGTCTTTCAAAGCTGCCCCG 60.891 55.000 0.00 0.00 0.00 5.73
590 591 4.802039 ACGTCTGCGGTACAATATGTTTAG 59.198 41.667 0.00 0.00 43.45 1.85
828 835 5.785940 AGGAGTTCCTGTTCATACTAAAGGT 59.214 40.000 0.00 0.00 46.55 3.50
965 972 3.799366 TGAACTTTTCGTGGAACAGCTA 58.201 40.909 0.00 0.00 41.80 3.32
1061 1068 1.092345 GGCGAGATCCCTTCAAGCAC 61.092 60.000 0.00 0.00 32.67 4.40
1081 1088 2.092646 ACGACTGCTCTCACCTCTCTAT 60.093 50.000 0.00 0.00 0.00 1.98
1332 1339 2.615391 TGGGTGGTCTTCTGTGTGATA 58.385 47.619 0.00 0.00 0.00 2.15
1984 1991 9.975218 ATAGTTTTCCAGTACTGACCAAATTAT 57.025 29.630 24.68 18.84 0.00 1.28
2007 2014 9.765795 TTATAGAGAGAAGTTAATTAGCTTGCC 57.234 33.333 18.03 9.83 0.00 4.52
2350 2357 1.227674 CAGCGTCTATGCCTTCCCC 60.228 63.158 0.00 0.00 34.65 4.81
2443 2450 5.548406 ACAGCGTTCTTACCTGAACTAAAT 58.452 37.500 0.00 0.00 42.82 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.677820 GCTGGTAGTGTGCCGGTTATT 60.678 52.381 1.90 0.00 34.91 1.40
478 479 9.696917 ATATGAAAGATCAACAAAAACAAGGTC 57.303 29.630 0.00 0.00 39.49 3.85
590 591 3.415457 TTTCAATGGGAATTTGGCCAC 57.585 42.857 3.88 0.00 34.91 5.01
735 736 2.282407 TGTCTGTGATCGATGGCATTG 58.718 47.619 0.54 8.51 0.00 2.82
965 972 2.551270 TCTCAGGGATAGCACCACTTT 58.449 47.619 0.00 0.00 0.00 2.66
1061 1068 2.031258 TAGAGAGGTGAGAGCAGTCG 57.969 55.000 0.00 0.00 0.00 4.18
1081 1088 6.761242 GTGTTGTATGACAGGTTCATATAGCA 59.239 38.462 4.28 4.28 46.73 3.49
1254 1261 6.924060 GGTAAAAGGATATATCATCGGATCCG 59.076 42.308 28.62 28.62 42.34 4.18
1984 1991 7.124298 TCAGGCAAGCTAATTAACTTCTCTCTA 59.876 37.037 0.00 0.00 0.00 2.43
2007 2014 2.426183 CGCCGAAGAACGTCGTCAG 61.426 63.158 0.00 0.00 38.54 3.51
2350 2357 5.468592 CCAGAGAGGATTTGATATCGACAG 58.531 45.833 0.00 0.00 41.22 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.