Multiple sequence alignment - TraesCS4A01G454100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G454100 chr4A 100.000 2654 0 0 484 3137 718185263 718182610 0.000000e+00 4902.0
1 TraesCS4A01G454100 chr4A 99.398 2656 14 1 484 3137 718079123 718076468 0.000000e+00 4815.0
2 TraesCS4A01G454100 chr4A 79.933 1495 231 47 821 2256 717051389 717049905 0.000000e+00 1035.0
3 TraesCS4A01G454100 chr4A 79.457 1363 217 51 831 2142 717045870 717044520 0.000000e+00 907.0
4 TraesCS4A01G454100 chr4A 78.896 1322 229 31 948 2225 716955547 716954232 0.000000e+00 850.0
5 TraesCS4A01G454100 chr4A 100.000 400 0 0 1 400 718185746 718185347 0.000000e+00 739.0
6 TraesCS4A01G454100 chr4A 95.227 419 1 1 1 400 718079722 718079304 0.000000e+00 645.0
7 TraesCS4A01G454100 chr4A 76.991 339 62 14 2555 2879 717049594 717049258 2.490000e-41 180.0
8 TraesCS4A01G454100 chr4A 81.522 92 17 0 1100 1191 714137529 714137438 3.350000e-10 76.8
9 TraesCS4A01G454100 chr4A 97.143 35 1 0 1769 1803 624983273 624983307 3.380000e-05 60.2
10 TraesCS4A01G454100 chr7D 92.169 1826 97 14 1241 3029 16571985 16573801 0.000000e+00 2538.0
11 TraesCS4A01G454100 chr7D 78.804 1321 204 43 948 2225 17344801 17346088 0.000000e+00 819.0
12 TraesCS4A01G454100 chr7D 79.681 940 146 31 831 1734 17214548 17215478 1.230000e-178 636.0
13 TraesCS4A01G454100 chr7D 83.709 577 85 3 1167 1734 17207121 17207697 1.280000e-148 536.0
14 TraesCS4A01G454100 chr7D 90.964 166 8 3 1 165 16571835 16571994 1.890000e-52 217.0
15 TraesCS4A01G454100 chr7D 77.206 272 48 12 2555 2814 17208299 17208568 2.520000e-31 147.0
16 TraesCS4A01G454100 chr7A 84.471 1494 193 26 922 2395 15534694 15533220 0.000000e+00 1437.0
17 TraesCS4A01G454100 chr7A 84.083 578 83 4 1091 1659 16596821 16597398 1.640000e-152 549.0
18 TraesCS4A01G454100 chr7A 81.395 430 62 13 816 1230 16596392 16596818 5.010000e-88 335.0
19 TraesCS4A01G454100 chr7A 77.419 341 58 16 2555 2879 16598572 16598909 5.340000e-43 185.0
20 TraesCS4A01G454100 chr7A 81.092 238 27 7 68 292 15535578 15535346 1.160000e-39 174.0
21 TraesCS4A01G454100 chr7A 77.070 314 55 12 1413 1722 667984569 667984269 6.960000e-37 165.0
22 TraesCS4A01G454100 chr7A 84.375 160 15 4 563 713 15535199 15535041 7.010000e-32 148.0
23 TraesCS4A01G454100 chr5D 95.000 40 2 0 1764 1803 544285246 544285207 2.610000e-06 63.9
24 TraesCS4A01G454100 chr5B 94.737 38 2 0 1766 1803 685950339 685950302 3.380000e-05 60.2
25 TraesCS4A01G454100 chr2D 90.244 41 4 0 1763 1803 84917723 84917763 2.000000e-03 54.7
26 TraesCS4A01G454100 chr2D 90.244 41 4 0 1763 1803 85674710 85674750 2.000000e-03 54.7
27 TraesCS4A01G454100 chr2A 100.000 29 0 0 1775 1803 84153021 84152993 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G454100 chr4A 718182610 718185746 3136 True 2820.500000 4902 100.000000 1 3137 2 chr4A.!!$R5 3136
1 TraesCS4A01G454100 chr4A 718076468 718079722 3254 True 2730.000000 4815 97.312500 1 3137 2 chr4A.!!$R4 3136
2 TraesCS4A01G454100 chr4A 716954232 716955547 1315 True 850.000000 850 78.896000 948 2225 1 chr4A.!!$R2 1277
3 TraesCS4A01G454100 chr4A 717044520 717051389 6869 True 707.333333 1035 78.793667 821 2879 3 chr4A.!!$R3 2058
4 TraesCS4A01G454100 chr7D 16571835 16573801 1966 False 1377.500000 2538 91.566500 1 3029 2 chr7D.!!$F3 3028
5 TraesCS4A01G454100 chr7D 17344801 17346088 1287 False 819.000000 819 78.804000 948 2225 1 chr7D.!!$F2 1277
6 TraesCS4A01G454100 chr7D 17214548 17215478 930 False 636.000000 636 79.681000 831 1734 1 chr7D.!!$F1 903
7 TraesCS4A01G454100 chr7D 17207121 17208568 1447 False 341.500000 536 80.457500 1167 2814 2 chr7D.!!$F4 1647
8 TraesCS4A01G454100 chr7A 15533220 15535578 2358 True 586.333333 1437 83.312667 68 2395 3 chr7A.!!$R2 2327
9 TraesCS4A01G454100 chr7A 16596392 16598909 2517 False 356.333333 549 80.965667 816 2879 3 chr7A.!!$F1 2063

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
183 211 1.076632 CGCTCTCTCCCCTACACCT 60.077 63.158 0.0 0.0 0.0 4.00 F
650 816 1.770061 ACCGGTCAAAACAAGTCCCTA 59.230 47.619 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1952 2722 1.153086 CCCCATCTTTCAGGGCTCG 60.153 63.158 0.0 0.0 44.06 5.03 R
2181 2973 2.817258 CTGTGTTGCGAGGGGAAAATTA 59.183 45.455 0.0 0.0 0.00 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 211 1.076632 CGCTCTCTCCCCTACACCT 60.077 63.158 0.00 0.0 0.00 4.00
526 684 7.324375 GCTAGCGTACGTTGTTGTATATATTGA 59.676 37.037 17.90 0.0 0.00 2.57
650 816 1.770061 ACCGGTCAAAACAAGTCCCTA 59.230 47.619 0.00 0.0 0.00 3.53
1952 2722 0.319405 AGCCAGCCATTTTCTTGCAC 59.681 50.000 0.00 0.0 0.00 4.57
2181 2973 2.770134 CTCTACGAGCTCCTGACGT 58.230 57.895 8.47 5.3 42.70 4.34
2360 3170 1.222115 GAAGTTGTCGCGCTTCCAGT 61.222 55.000 5.56 0.0 36.14 4.00
2891 4633 4.345547 TGGGACCACAAAAGGAAAATTACC 59.654 41.667 0.00 0.0 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 211 4.070681 AGCTACCTAGGGTTTACAGGAA 57.929 45.455 14.81 0.00 37.09 3.36
526 684 5.478679 ACTCTAGTCTAGTGACAACAATGCT 59.521 40.000 14.44 0.00 45.20 3.79
650 816 9.507329 AATATAGCACGATAACATTCAGGAAAT 57.493 29.630 0.00 0.00 0.00 2.17
1369 1849 5.520748 AGTTGACCATAGGAAGTTCCAAT 57.479 39.130 23.87 6.79 39.61 3.16
1952 2722 1.153086 CCCCATCTTTCAGGGCTCG 60.153 63.158 0.00 0.00 44.06 5.03
2181 2973 2.817258 CTGTGTTGCGAGGGGAAAATTA 59.183 45.455 0.00 0.00 0.00 1.40
2911 4654 2.705658 TCAGACAGTGTGTTCCCTGAAT 59.294 45.455 0.00 0.00 29.43 2.57
2917 4660 4.393062 CCATATGTTCAGACAGTGTGTTCC 59.607 45.833 0.00 0.00 39.58 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.