Multiple sequence alignment - TraesCS4A01G437700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G437700 chr4A 100.000 2756 0 0 1 2756 707401915 707404670 0.000000e+00 5090.0
1 TraesCS4A01G437700 chr4A 97.295 2329 63 0 1 2329 705888443 705890771 0.000000e+00 3952.0
2 TraesCS4A01G437700 chr4A 93.838 1428 61 6 908 2323 707177748 707179160 0.000000e+00 2124.0
3 TraesCS4A01G437700 chr4A 93.838 1428 61 6 908 2323 707201273 707202685 0.000000e+00 2124.0
4 TraesCS4A01G437700 chr4A 92.559 1317 80 8 908 2207 707478356 707477041 0.000000e+00 1873.0
5 TraesCS4A01G437700 chr4A 91.734 1234 98 2 908 2137 706094841 706096074 0.000000e+00 1711.0
6 TraesCS4A01G437700 chr4A 94.737 418 14 2 2330 2739 705890903 705891320 0.000000e+00 643.0
7 TraesCS4A01G437700 chr4A 92.260 323 13 1 1897 2207 705906546 705906868 5.410000e-122 448.0
8 TraesCS4A01G437700 chr7D 88.755 1743 138 24 908 2602 24032554 24034286 0.000000e+00 2080.0
9 TraesCS4A01G437700 chr7D 87.514 1730 132 43 936 2590 24157228 24155508 0.000000e+00 1921.0
10 TraesCS4A01G437700 chr7D 87.666 1435 142 21 908 2310 53793325 53791894 0.000000e+00 1637.0
11 TraesCS4A01G437700 chrUn 92.220 1234 92 2 908 2137 220054912 220056145 0.000000e+00 1744.0
12 TraesCS4A01G437700 chr7A 88.432 1435 128 21 908 2310 57219302 57217874 0.000000e+00 1696.0
13 TraesCS4A01G437700 chr7A 83.951 81 13 0 770 850 692457566 692457646 8.180000e-11 78.7
14 TraesCS4A01G437700 chr3A 81.074 745 97 13 168 877 231742764 231742029 3.100000e-154 555.0
15 TraesCS4A01G437700 chr3A 82.895 76 9 4 777 850 80431761 80431834 6.370000e-07 65.8
16 TraesCS4A01G437700 chr1A 77.310 736 122 26 172 879 249024963 249024245 2.570000e-105 392.0
17 TraesCS4A01G437700 chr1A 76.471 323 51 17 441 748 408070800 408070488 4.750000e-33 152.0
18 TraesCS4A01G437700 chr1A 73.303 442 75 20 440 840 86652063 86652502 3.730000e-24 122.0
19 TraesCS4A01G437700 chr6A 76.552 725 99 26 170 858 62917544 62916855 5.690000e-87 331.0
20 TraesCS4A01G437700 chr6A 81.773 203 25 5 554 752 54120914 54121108 2.840000e-35 159.0
21 TraesCS4A01G437700 chr2D 78.393 361 44 17 516 853 115595010 115594661 1.290000e-48 204.0
22 TraesCS4A01G437700 chr6B 89.103 156 14 3 2603 2756 677567615 677567461 1.010000e-44 191.0
23 TraesCS4A01G437700 chr6D 88.462 156 16 2 2603 2756 447510701 447510546 1.300000e-43 187.0
24 TraesCS4A01G437700 chr6D 74.432 352 59 15 548 876 435810889 435810546 3.730000e-24 122.0
25 TraesCS4A01G437700 chr6D 85.915 71 9 1 781 851 435810684 435810615 1.060000e-09 75.0
26 TraesCS4A01G437700 chr3B 81.046 153 20 3 178 329 170832008 170832152 2.240000e-21 113.0
27 TraesCS4A01G437700 chr4D 90.476 63 4 2 2696 2756 495983839 495983777 6.330000e-12 82.4
28 TraesCS4A01G437700 chr7B 78.261 115 23 2 755 868 700558844 700558731 3.810000e-09 73.1
29 TraesCS4A01G437700 chr7B 80.488 82 15 1 762 843 747328542 747328462 8.240000e-06 62.1
30 TraesCS4A01G437700 chr2A 79.775 89 17 1 755 843 12319053 12319140 2.290000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G437700 chr4A 707401915 707404670 2755 False 5090.0 5090 100.000 1 2756 1 chr4A.!!$F5 2755
1 TraesCS4A01G437700 chr4A 705888443 705891320 2877 False 2297.5 3952 96.016 1 2739 2 chr4A.!!$F6 2738
2 TraesCS4A01G437700 chr4A 707177748 707179160 1412 False 2124.0 2124 93.838 908 2323 1 chr4A.!!$F3 1415
3 TraesCS4A01G437700 chr4A 707201273 707202685 1412 False 2124.0 2124 93.838 908 2323 1 chr4A.!!$F4 1415
4 TraesCS4A01G437700 chr4A 707477041 707478356 1315 True 1873.0 1873 92.559 908 2207 1 chr4A.!!$R1 1299
5 TraesCS4A01G437700 chr4A 706094841 706096074 1233 False 1711.0 1711 91.734 908 2137 1 chr4A.!!$F2 1229
6 TraesCS4A01G437700 chr7D 24032554 24034286 1732 False 2080.0 2080 88.755 908 2602 1 chr7D.!!$F1 1694
7 TraesCS4A01G437700 chr7D 24155508 24157228 1720 True 1921.0 1921 87.514 936 2590 1 chr7D.!!$R1 1654
8 TraesCS4A01G437700 chr7D 53791894 53793325 1431 True 1637.0 1637 87.666 908 2310 1 chr7D.!!$R2 1402
9 TraesCS4A01G437700 chrUn 220054912 220056145 1233 False 1744.0 1744 92.220 908 2137 1 chrUn.!!$F1 1229
10 TraesCS4A01G437700 chr7A 57217874 57219302 1428 True 1696.0 1696 88.432 908 2310 1 chr7A.!!$R1 1402
11 TraesCS4A01G437700 chr3A 231742029 231742764 735 True 555.0 555 81.074 168 877 1 chr3A.!!$R1 709
12 TraesCS4A01G437700 chr1A 249024245 249024963 718 True 392.0 392 77.310 172 879 1 chr1A.!!$R1 707
13 TraesCS4A01G437700 chr6A 62916855 62917544 689 True 331.0 331 76.552 170 858 1 chr6A.!!$R1 688

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
208 209 0.100503 GGCGGATGTTTATGTGTGCC 59.899 55.0 0.0 0.0 0.0 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2177 2269 1.135373 TCGGCAGTCGAACAGAGATTC 60.135 52.381 0.0 0.0 45.86 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 209 0.100503 GGCGGATGTTTATGTGTGCC 59.899 55.000 0.00 0.00 0.00 5.01
221 222 1.461268 TGTGCCTCCACCTTCTCCA 60.461 57.895 0.00 0.00 41.35 3.86
331 332 2.884639 CCTCACCGAAACAAATGGTCTT 59.115 45.455 0.00 0.00 32.48 3.01
346 347 1.600413 GGTCTTTTGCAAACCGAGCAG 60.600 52.381 24.04 14.49 43.75 4.24
1022 1078 2.225467 GCCTGCAAACAAGACTTCTCT 58.775 47.619 0.00 0.00 0.00 3.10
1041 1097 1.405821 CTAGCGAATCAGAAGGACGGT 59.594 52.381 0.00 0.00 38.22 4.83
1126 1182 0.806102 CCTACGCAGTCCATTCGTGG 60.806 60.000 0.00 0.00 43.93 4.94
1413 1469 2.690881 TTCCCCATACCTGCGGCT 60.691 61.111 0.00 0.00 0.00 5.52
2184 2288 1.213926 GGGCCATCCAACAGAATCTCT 59.786 52.381 4.39 0.00 35.00 3.10
2267 2374 2.238521 GTGGGGTTGTGTGATCAACAT 58.761 47.619 0.00 0.00 46.36 2.71
2302 2409 2.877974 GCCGGCCTAATAACGCACG 61.878 63.158 18.11 0.00 0.00 5.34
2499 2765 4.344679 TGTGGGAGCTCAAATTCACAAATT 59.655 37.500 17.19 0.00 36.64 1.82
2594 2864 8.511604 AATGTATATTGTTTGTCTTCCCTCAG 57.488 34.615 0.00 0.00 0.00 3.35
2606 2876 4.349342 GTCTTCCCTCAGAATGTATGGGAT 59.651 45.833 0.00 0.00 45.00 3.85
2616 2886 1.924731 TGTATGGGATCGGCTAGAGG 58.075 55.000 0.00 0.00 0.00 3.69
2680 2951 4.562394 ACAATTTGTTTCAGTCAACTTGCG 59.438 37.500 0.00 0.00 38.27 4.85
2699 2970 1.821936 CCTAGCTGACAGGCTCAGG 59.178 63.158 4.26 6.38 46.08 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 209 0.390860 CGGCTATGGAGAAGGTGGAG 59.609 60.000 0.00 0.00 0.00 3.86
221 222 2.878406 CCAAATCAAATCCGACGGCTAT 59.122 45.455 9.66 0.00 0.00 2.97
331 332 1.646540 CGACTGCTCGGTTTGCAAA 59.353 52.632 8.05 8.05 40.13 3.68
706 727 8.145767 TCTTCTCTAATTTTCCGTAACAAGACA 58.854 33.333 0.00 0.00 0.00 3.41
905 944 8.286097 GGAATTTATAGAGCGATTTTCTTCAGG 58.714 37.037 0.00 0.00 0.00 3.86
1022 1078 1.404391 GACCGTCCTTCTGATTCGCTA 59.596 52.381 0.00 0.00 0.00 4.26
1041 1097 5.134202 ACATGTCAACAGAGATGTTACGA 57.866 39.130 2.81 0.00 41.78 3.43
2177 2269 1.135373 TCGGCAGTCGAACAGAGATTC 60.135 52.381 0.00 0.00 45.86 2.52
2267 2374 2.343101 CGGCCGTCATCTAGAAAAACA 58.657 47.619 19.50 0.00 0.00 2.83
2302 2409 9.884465 GGTACAGAATGAGACATTAATTTATGC 57.116 33.333 4.38 0.00 39.69 3.14
2594 2864 3.118956 CCTCTAGCCGATCCCATACATTC 60.119 52.174 0.00 0.00 0.00 2.67
2606 2876 3.083122 AGTCAACTTACCTCTAGCCGA 57.917 47.619 0.00 0.00 0.00 5.54
2653 2923 5.650543 AGTTGACTGAAACAAATTGTGGTC 58.349 37.500 0.00 7.04 32.21 4.02
2699 2970 1.883084 CTCCACGTAGCAATCGCCC 60.883 63.158 0.00 0.00 39.83 6.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.