Multiple sequence alignment - TraesCS4A01G421700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G421700 chr4A 100.000 4123 0 0 1 4123 692163614 692167736 0.000000e+00 7614
1 TraesCS4A01G421700 chr4A 99.298 3276 20 1 848 4123 692087304 692090576 0.000000e+00 5919
2 TraesCS4A01G421700 chr4A 98.804 3177 31 3 1 3177 692259270 692262439 0.000000e+00 5650
3 TraesCS4A01G421700 chr4A 84.058 690 70 17 1 669 692085629 692086299 2.710000e-176 628
4 TraesCS4A01G421700 chr4A 84.016 488 54 15 1 477 692082987 692083461 8.130000e-122 448
5 TraesCS4A01G421700 chr4A 88.235 187 15 2 665 844 692087030 692087216 2.500000e-52 217
6 TraesCS4A01G421700 chr7A 95.649 1471 52 6 1715 3180 33737074 33735611 0.000000e+00 2351
7 TraesCS4A01G421700 chr7A 89.638 1573 121 24 1833 3385 33985299 33983749 0.000000e+00 1964
8 TraesCS4A01G421700 chr7A 96.011 702 25 1 2445 3146 33664158 33663460 0.000000e+00 1138
9 TraesCS4A01G421700 chr7A 86.891 923 71 20 552 1452 33679437 33678543 0.000000e+00 989
10 TraesCS4A01G421700 chr7A 90.515 738 53 6 1833 2556 33971870 33971136 0.000000e+00 959
11 TraesCS4A01G421700 chr7A 87.022 863 77 17 1575 2419 33666880 33666035 0.000000e+00 941
12 TraesCS4A01G421700 chr7A 91.864 676 42 11 1052 1719 33738574 33737904 0.000000e+00 931
13 TraesCS4A01G421700 chr7A 85.901 688 47 20 848 1522 33972523 33971873 0.000000e+00 688
14 TraesCS4A01G421700 chr7A 86.281 605 48 11 1 594 33986864 33986284 3.500000e-175 625
15 TraesCS4A01G421700 chr7A 85.950 605 50 11 1 594 33973457 33972877 7.570000e-172 614
16 TraesCS4A01G421700 chr7A 81.924 686 56 24 848 1522 33985930 33985302 6.110000e-143 518
17 TraesCS4A01G421700 chr7A 88.655 238 24 3 175 410 33720524 33720288 1.880000e-73 287
18 TraesCS4A01G421700 chr7A 85.116 215 22 7 851 1059 33740878 33740668 1.160000e-50 211
19 TraesCS4A01G421700 chr7A 90.972 144 9 2 704 844 33972705 33972563 1.510000e-44 191
20 TraesCS4A01G421700 chr7A 90.972 144 9 2 704 844 33986112 33985970 1.510000e-44 191
21 TraesCS4A01G421700 chr7A 87.179 156 6 4 413 554 33720145 33719990 9.170000e-37 165
22 TraesCS4A01G421700 chr7A 86.000 150 13 4 522 671 33741628 33741487 1.980000e-33 154
23 TraesCS4A01G421700 chr7A 95.062 81 3 1 3986 4065 53263381 53263461 4.330000e-25 126
24 TraesCS4A01G421700 chr7A 81.818 121 18 3 1 117 33759024 33758904 9.430000e-17 99
25 TraesCS4A01G421700 chr7D 89.267 1677 127 28 1833 3488 33465141 33463497 0.000000e+00 2050
26 TraesCS4A01G421700 chr7D 85.901 688 47 20 848 1522 33465794 33465144 0.000000e+00 688
27 TraesCS4A01G421700 chr7D 86.446 605 48 10 1 594 33466731 33466150 2.090000e-177 632
28 TraesCS4A01G421700 chr7D 92.715 151 7 2 704 851 33465984 33465835 8.980000e-52 215
29 TraesCS4A01G421700 chrUn 95.062 81 3 1 3986 4065 52409505 52409425 4.330000e-25 126
30 TraesCS4A01G421700 chr6B 95.062 81 3 1 3986 4065 267020722 267020802 4.330000e-25 126
31 TraesCS4A01G421700 chr6A 95.062 81 3 1 3986 4065 32557813 32557733 4.330000e-25 126
32 TraesCS4A01G421700 chr5B 95.062 81 3 1 3986 4065 259549870 259549950 4.330000e-25 126
33 TraesCS4A01G421700 chr4B 95.062 81 3 1 3986 4065 18970542 18970622 4.330000e-25 126
34 TraesCS4A01G421700 chr4B 95.062 81 3 1 3986 4065 95680739 95680819 4.330000e-25 126
35 TraesCS4A01G421700 chr4B 90.426 94 7 2 3974 4065 599464413 599464506 5.600000e-24 122


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G421700 chr4A 692163614 692167736 4122 False 7614.00 7614 100.00000 1 4123 1 chr4A.!!$F1 4122
1 TraesCS4A01G421700 chr4A 692259270 692262439 3169 False 5650.00 5650 98.80400 1 3177 1 chr4A.!!$F2 3176
2 TraesCS4A01G421700 chr4A 692082987 692090576 7589 False 1803.00 5919 88.90175 1 4123 4 chr4A.!!$F3 4122
3 TraesCS4A01G421700 chr7A 33663460 33666880 3420 True 1039.50 1138 91.51650 1575 3146 2 chr7A.!!$R3 1571
4 TraesCS4A01G421700 chr7A 33678543 33679437 894 True 989.00 989 86.89100 552 1452 1 chr7A.!!$R1 900
5 TraesCS4A01G421700 chr7A 33735611 33741628 6017 True 911.75 2351 89.65725 522 3180 4 chr7A.!!$R5 2658
6 TraesCS4A01G421700 chr7A 33983749 33986864 3115 True 824.50 1964 87.20375 1 3385 4 chr7A.!!$R7 3384
7 TraesCS4A01G421700 chr7A 33971136 33973457 2321 True 613.00 959 88.33450 1 2556 4 chr7A.!!$R6 2555
8 TraesCS4A01G421700 chr7A 33719990 33720524 534 True 226.00 287 87.91700 175 554 2 chr7A.!!$R4 379
9 TraesCS4A01G421700 chr7D 33463497 33466731 3234 True 896.25 2050 88.58225 1 3488 4 chr7D.!!$R1 3487

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1374 7521 1.517257 CCCGTGTCATCAGCTCGAC 60.517 63.158 1.32 1.32 0.00 4.20 F
1874 8870 6.021074 CGGTGGCAAAATTTTAAAAAGTTTGC 60.021 34.615 32.44 32.44 44.13 3.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2428 9440 6.763355 AGTTAGACATATATCCTGCAGGTTG 58.237 40.000 31.58 21.99 36.34 3.77 R
3541 12418 2.358737 CCACTCCGTTGGCACCTC 60.359 66.667 0.00 0.00 0.00 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1374 7521 1.517257 CCCGTGTCATCAGCTCGAC 60.517 63.158 1.32 1.32 0.00 4.20
1447 7600 6.127925 TGCAATTGTGTGGTTTTTATTTTGCA 60.128 30.769 7.40 0.00 42.18 4.08
1874 8870 6.021074 CGGTGGCAAAATTTTAAAAAGTTTGC 60.021 34.615 32.44 32.44 44.13 3.68
2428 9440 9.155975 TGTCTCTTTATTGAAGACTATTGAAGC 57.844 33.333 3.69 0.00 39.44 3.86
3007 11880 7.816513 CGACATTGAGGATATTATGTCTGACAT 59.183 37.037 25.01 25.01 42.83 3.06
3079 11952 8.611654 AGTAATTTGTACGGTCTTGTAATGTT 57.388 30.769 0.00 0.00 0.00 2.71
3428 12305 2.433838 CACTGCTCCTGCCACTCG 60.434 66.667 0.00 0.00 38.71 4.18
3541 12418 1.218316 GGCAAGTAGGACACGAGGG 59.782 63.158 0.00 0.00 0.00 4.30
3669 12546 2.731572 CTTGATGGAATGCACTCCCTT 58.268 47.619 12.49 0.00 34.22 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1374 7521 1.009829 GCGCAGATAACAGACTTGGG 58.990 55.000 0.30 0.00 0.00 4.12
2428 9440 6.763355 AGTTAGACATATATCCTGCAGGTTG 58.237 40.000 31.58 21.99 36.34 3.77
3541 12418 2.358737 CCACTCCGTTGGCACCTC 60.359 66.667 0.00 0.00 0.00 3.85
3669 12546 4.033709 AGAGCTATTTGTCCCTCAGCTAA 58.966 43.478 0.00 0.00 42.44 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.