Multiple sequence alignment - TraesCS4A01G416200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G416200 chr4A 100.000 2363 0 0 1 2363 685937256 685934894 0.000000e+00 4364.0
1 TraesCS4A01G416200 chr4A 94.100 2356 111 8 11 2363 685921618 685919288 0.000000e+00 3555.0
2 TraesCS4A01G416200 chr4A 94.263 1255 59 4 11 1263 685905304 685904061 0.000000e+00 1906.0
3 TraesCS4A01G416200 chr4A 91.105 1394 109 14 977 2363 490559431 490560816 0.000000e+00 1873.0
4 TraesCS4A01G416200 chr4A 95.747 1105 47 0 1259 2363 685855971 685854867 0.000000e+00 1781.0
5 TraesCS4A01G416200 chr4A 90.022 1393 108 12 977 2363 490551019 490552386 0.000000e+00 1773.0
6 TraesCS4A01G416200 chr4A 95.014 702 30 5 12 710 563299953 563300652 0.000000e+00 1098.0
7 TraesCS4A01G416200 chr4A 94.118 51 2 1 796 845 17504433 17504383 2.520000e-10 76.8
8 TraesCS4A01G416200 chr7A 92.430 1321 82 15 1051 2362 394887300 394888611 0.000000e+00 1869.0
9 TraesCS4A01G416200 chr7A 96.576 701 21 3 12 710 337982247 337981548 0.000000e+00 1158.0
10 TraesCS4A01G416200 chr7A 89.368 649 59 9 1718 2363 263158581 263157940 0.000000e+00 808.0
11 TraesCS4A01G416200 chr2A 90.374 1392 104 11 978 2363 661854445 661855812 0.000000e+00 1801.0
12 TraesCS4A01G416200 chr2A 91.597 952 72 7 1415 2363 661846649 661847595 0.000000e+00 1308.0
13 TraesCS4A01G416200 chr2A 89.860 927 89 4 956 1880 275352173 275353096 0.000000e+00 1186.0
14 TraesCS4A01G416200 chr2A 96.576 701 21 3 12 710 492908715 492909414 0.000000e+00 1158.0
15 TraesCS4A01G416200 chr2A 95.461 705 26 4 11 710 492916624 492917327 0.000000e+00 1120.0
16 TraesCS4A01G416200 chr2A 94.744 704 31 6 11 710 461436235 461435534 0.000000e+00 1090.0
17 TraesCS4A01G416200 chr2A 91.346 104 7 2 682 783 387965058 387965161 8.800000e-30 141.0
18 TraesCS4A01G416200 chr6A 91.294 1321 92 18 1051 2362 395305641 395304335 0.000000e+00 1781.0
19 TraesCS4A01G416200 chr6A 91.179 1315 105 8 1054 2362 395313807 395312498 0.000000e+00 1775.0
20 TraesCS4A01G416200 chr6A 96.719 701 21 2 11 710 127780518 127779819 0.000000e+00 1166.0
21 TraesCS4A01G416200 chr6A 96.571 700 22 2 12 710 127788643 127787945 0.000000e+00 1158.0
22 TraesCS4A01G416200 chr5A 93.586 1185 76 0 696 1880 108745124 108743940 0.000000e+00 1768.0
23 TraesCS4A01G416200 chr5A 91.246 891 78 0 941 1831 304713226 304712336 0.000000e+00 1214.0
24 TraesCS4A01G416200 chr5A 95.455 88 4 0 696 783 481595374 481595287 8.800000e-30 141.0
25 TraesCS4A01G416200 chr1A 97.000 700 17 3 12 710 301937536 301936840 0.000000e+00 1173.0
26 TraesCS4A01G416200 chr3A 89.676 649 57 9 1718 2363 393773540 393772899 0.000000e+00 819.0
27 TraesCS4A01G416200 chr6B 87.821 156 18 1 956 1110 609239833 609239678 5.190000e-42 182.0
28 TraesCS4A01G416200 chr6B 86.624 157 18 3 956 1110 562230606 562230451 1.120000e-38 171.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G416200 chr4A 685934894 685937256 2362 True 4364 4364 100.000 1 2363 1 chr4A.!!$R5 2362
1 TraesCS4A01G416200 chr4A 685919288 685921618 2330 True 3555 3555 94.100 11 2363 1 chr4A.!!$R4 2352
2 TraesCS4A01G416200 chr4A 685904061 685905304 1243 True 1906 1906 94.263 11 1263 1 chr4A.!!$R3 1252
3 TraesCS4A01G416200 chr4A 490559431 490560816 1385 False 1873 1873 91.105 977 2363 1 chr4A.!!$F2 1386
4 TraesCS4A01G416200 chr4A 685854867 685855971 1104 True 1781 1781 95.747 1259 2363 1 chr4A.!!$R2 1104
5 TraesCS4A01G416200 chr4A 490551019 490552386 1367 False 1773 1773 90.022 977 2363 1 chr4A.!!$F1 1386
6 TraesCS4A01G416200 chr4A 563299953 563300652 699 False 1098 1098 95.014 12 710 1 chr4A.!!$F3 698
7 TraesCS4A01G416200 chr7A 394887300 394888611 1311 False 1869 1869 92.430 1051 2362 1 chr7A.!!$F1 1311
8 TraesCS4A01G416200 chr7A 337981548 337982247 699 True 1158 1158 96.576 12 710 1 chr7A.!!$R2 698
9 TraesCS4A01G416200 chr7A 263157940 263158581 641 True 808 808 89.368 1718 2363 1 chr7A.!!$R1 645
10 TraesCS4A01G416200 chr2A 661854445 661855812 1367 False 1801 1801 90.374 978 2363 1 chr2A.!!$F6 1385
11 TraesCS4A01G416200 chr2A 661846649 661847595 946 False 1308 1308 91.597 1415 2363 1 chr2A.!!$F5 948
12 TraesCS4A01G416200 chr2A 275352173 275353096 923 False 1186 1186 89.860 956 1880 1 chr2A.!!$F1 924
13 TraesCS4A01G416200 chr2A 492908715 492909414 699 False 1158 1158 96.576 12 710 1 chr2A.!!$F3 698
14 TraesCS4A01G416200 chr2A 492916624 492917327 703 False 1120 1120 95.461 11 710 1 chr2A.!!$F4 699
15 TraesCS4A01G416200 chr2A 461435534 461436235 701 True 1090 1090 94.744 11 710 1 chr2A.!!$R1 699
16 TraesCS4A01G416200 chr6A 395304335 395305641 1306 True 1781 1781 91.294 1051 2362 1 chr6A.!!$R3 1311
17 TraesCS4A01G416200 chr6A 395312498 395313807 1309 True 1775 1775 91.179 1054 2362 1 chr6A.!!$R4 1308
18 TraesCS4A01G416200 chr6A 127779819 127780518 699 True 1166 1166 96.719 11 710 1 chr6A.!!$R1 699
19 TraesCS4A01G416200 chr6A 127787945 127788643 698 True 1158 1158 96.571 12 710 1 chr6A.!!$R2 698
20 TraesCS4A01G416200 chr5A 108743940 108745124 1184 True 1768 1768 93.586 696 1880 1 chr5A.!!$R1 1184
21 TraesCS4A01G416200 chr5A 304712336 304713226 890 True 1214 1214 91.246 941 1831 1 chr5A.!!$R2 890
22 TraesCS4A01G416200 chr1A 301936840 301937536 696 True 1173 1173 97.000 12 710 1 chr1A.!!$R1 698
23 TraesCS4A01G416200 chr3A 393772899 393773540 641 True 819 819 89.676 1718 2363 1 chr3A.!!$R1 645

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
24 25 0.178958 ACCCATTGTAACGCCCCAAA 60.179 50.0 0.0 0.0 0.0 3.28 F
1184 1200 0.546747 CTGACCTCCCCTGTTACCCA 60.547 60.0 0.0 0.0 0.0 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1218 1234 1.475280 CCGAGGTGGATGACGAAGTAA 59.525 52.381 0.00 0.0 41.14 2.24 R
2094 2113 0.826715 CAGGTGTCCCATGAGACGAT 59.173 55.000 2.68 0.0 39.77 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 0.178958 ACCCATTGTAACGCCCCAAA 60.179 50.000 0.00 0.00 0.00 3.28
110 111 4.808895 GCATTCATCATTGCATCATGTTGT 59.191 37.500 5.69 0.00 38.72 3.32
643 655 1.220750 ACCCTACCCGATCTCATCCTT 59.779 52.381 0.00 0.00 0.00 3.36
953 968 1.520342 CTTCTAGCGCCACCAGCTC 60.520 63.158 2.29 0.00 44.79 4.09
954 969 1.954362 CTTCTAGCGCCACCAGCTCT 61.954 60.000 2.29 0.00 44.79 4.09
1160 1176 2.186160 CAAGTTCAGCACCACCGCA 61.186 57.895 0.00 0.00 0.00 5.69
1184 1200 0.546747 CTGACCTCCCCTGTTACCCA 60.547 60.000 0.00 0.00 0.00 4.51
1218 1234 1.477685 ATCTTCAACCGTGGGACCGT 61.478 55.000 0.00 0.00 0.00 4.83
1403 1421 1.228521 TTGACCCCGGACGTCTACA 60.229 57.895 16.46 4.42 0.00 2.74
1728 1747 1.159285 CTACCGTCACGAGTACCACA 58.841 55.000 0.00 0.00 0.00 4.17
2094 2113 2.593026 CCCTCTTTTGCCTTGTTACCA 58.407 47.619 0.00 0.00 0.00 3.25
2102 2121 1.621317 TGCCTTGTTACCATCGTCTCA 59.379 47.619 0.00 0.00 0.00 3.27
2160 2179 1.154413 CACGCATTCGCACACTTCC 60.154 57.895 0.00 0.00 39.84 3.46
2161 2180 1.301716 ACGCATTCGCACACTTCCT 60.302 52.632 0.00 0.00 39.84 3.36
2231 2251 1.195222 GGCACCGTTTCGTTATCGTTT 59.805 47.619 0.00 0.00 38.33 3.60
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 0.035247 TGGGGCGTTACAATGGGTAC 60.035 55.000 0.00 0.0 0.00 3.34
4 5 0.697079 TTGGGGCGTTACAATGGGTA 59.303 50.000 0.00 0.0 0.00 3.69
5 6 0.178958 TTTGGGGCGTTACAATGGGT 60.179 50.000 0.00 0.0 0.00 4.51
8 9 1.667467 CGGTTTTGGGGCGTTACAATG 60.667 52.381 0.00 0.0 0.00 2.82
9 10 0.599060 CGGTTTTGGGGCGTTACAAT 59.401 50.000 0.00 0.0 0.00 2.71
24 25 1.078143 GGCATCTGAAGCTCCGGTT 60.078 57.895 0.00 0.0 0.00 4.44
643 655 2.277072 CGAGGGGAGAGCAGAGGA 59.723 66.667 0.00 0.0 0.00 3.71
773 785 0.469917 GGAGGAGAATGAATCGGGCA 59.530 55.000 0.00 0.0 0.00 5.36
1048 1063 3.164269 CAGCAGGGGCCGGTAGAT 61.164 66.667 1.90 0.0 42.56 1.98
1049 1064 4.392166 TCAGCAGGGGCCGGTAGA 62.392 66.667 1.90 0.0 42.56 2.59
1073 1088 2.124983 GCTTGCTGATGAGGCGGA 60.125 61.111 0.00 0.0 0.00 5.54
1160 1176 2.049792 AACAGGGGAGGTCAGAGGGT 62.050 60.000 0.00 0.0 0.00 4.34
1184 1200 1.732259 GAAGATGAACGGCGACAATGT 59.268 47.619 16.62 0.0 0.00 2.71
1218 1234 1.475280 CCGAGGTGGATGACGAAGTAA 59.525 52.381 0.00 0.0 41.14 2.24
1403 1421 2.621998 CGGTCGTAGAGGTCCACATATT 59.378 50.000 0.00 0.0 36.95 1.28
1884 1903 1.617357 GAGGGAAGTAGTGGTTCACGT 59.383 52.381 0.00 0.0 39.64 4.49
2094 2113 0.826715 CAGGTGTCCCATGAGACGAT 59.173 55.000 2.68 0.0 39.77 3.73
2102 2121 1.635817 CCGGATTCCAGGTGTCCCAT 61.636 60.000 0.00 0.0 0.00 4.00
2160 2179 4.149571 CGATTGAGATACCGATGCAAAGAG 59.850 45.833 0.00 0.0 0.00 2.85
2161 2180 4.051237 CGATTGAGATACCGATGCAAAGA 58.949 43.478 0.00 0.0 0.00 2.52
2231 2251 2.957402 ATGAAAAGGAGTGCCACAGA 57.043 45.000 0.00 0.0 36.29 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.