Multiple sequence alignment - TraesCS4A01G397500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G397500 chr4A 100.000 3070 0 0 1 3070 672795633 672792564 0.000000e+00 5670
1 TraesCS4A01G397500 chr4A 99.153 3071 25 1 1 3070 672635270 672632200 0.000000e+00 5526
2 TraesCS4A01G397500 chr4A 99.153 3070 24 1 1 3070 672656858 672653791 0.000000e+00 5524
3 TraesCS4A01G397500 chr4A 98.860 3070 29 4 1 3070 672677403 672674340 0.000000e+00 5470
4 TraesCS4A01G397500 chr4A 98.795 3070 33 3 1 3070 672596049 672592984 0.000000e+00 5461
5 TraesCS4A01G397500 chr4A 96.877 3074 80 9 1 3070 672774372 672771311 0.000000e+00 5131
6 TraesCS4A01G397500 chr4A 96.842 3072 77 12 1 3070 672924126 672921073 0.000000e+00 5118
7 TraesCS4A01G397500 chr4A 96.548 3071 76 11 1 3070 672734348 672731307 0.000000e+00 5057
8 TraesCS4A01G397500 chr4A 96.322 3072 81 8 1 3070 672879934 672876893 0.000000e+00 5018
9 TraesCS4A01G397500 chrUn 98.382 1792 23 4 387 2178 372313513 372315298 0.000000e+00 3144
10 TraesCS4A01G397500 chrUn 98.290 1579 23 3 600 2178 387936892 387938466 0.000000e+00 2763
11 TraesCS4A01G397500 chr7A 92.030 1719 98 15 1386 3070 60508639 60506926 0.000000e+00 2379
12 TraesCS4A01G397500 chr7A 93.079 1546 95 9 1375 2913 60058419 60056879 0.000000e+00 2252
13 TraesCS4A01G397500 chr7A 93.014 1546 95 10 1375 2913 59933891 59932352 0.000000e+00 2244
14 TraesCS4A01G397500 chr7A 95.161 434 19 2 1 434 60511628 60511197 0.000000e+00 684
15 TraesCS4A01G397500 chr7A 89.683 126 12 1 2945 3070 59932371 59932247 3.170000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G397500 chr4A 672792564 672795633 3069 True 5670.0 5670 100.0000 1 3070 1 chr4A.!!$R7 3069
1 TraesCS4A01G397500 chr4A 672632200 672635270 3070 True 5526.0 5526 99.1530 1 3070 1 chr4A.!!$R2 3069
2 TraesCS4A01G397500 chr4A 672653791 672656858 3067 True 5524.0 5524 99.1530 1 3070 1 chr4A.!!$R3 3069
3 TraesCS4A01G397500 chr4A 672674340 672677403 3063 True 5470.0 5470 98.8600 1 3070 1 chr4A.!!$R4 3069
4 TraesCS4A01G397500 chr4A 672592984 672596049 3065 True 5461.0 5461 98.7950 1 3070 1 chr4A.!!$R1 3069
5 TraesCS4A01G397500 chr4A 672771311 672774372 3061 True 5131.0 5131 96.8770 1 3070 1 chr4A.!!$R6 3069
6 TraesCS4A01G397500 chr4A 672921073 672924126 3053 True 5118.0 5118 96.8420 1 3070 1 chr4A.!!$R9 3069
7 TraesCS4A01G397500 chr4A 672731307 672734348 3041 True 5057.0 5057 96.5480 1 3070 1 chr4A.!!$R5 3069
8 TraesCS4A01G397500 chr4A 672876893 672879934 3041 True 5018.0 5018 96.3220 1 3070 1 chr4A.!!$R8 3069
9 TraesCS4A01G397500 chrUn 372313513 372315298 1785 False 3144.0 3144 98.3820 387 2178 1 chrUn.!!$F1 1791
10 TraesCS4A01G397500 chrUn 387936892 387938466 1574 False 2763.0 2763 98.2900 600 2178 1 chrUn.!!$F2 1578
11 TraesCS4A01G397500 chr7A 60056879 60058419 1540 True 2252.0 2252 93.0790 1375 2913 1 chr7A.!!$R1 1538
12 TraesCS4A01G397500 chr7A 60506926 60511628 4702 True 1531.5 2379 93.5955 1 3070 2 chr7A.!!$R3 3069
13 TraesCS4A01G397500 chr7A 59932247 59933891 1644 True 1201.5 2244 91.3485 1375 3070 2 chr7A.!!$R2 1695

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
774 826 8.680903 CATGCAAACTAACAATCTAATCTCCTT 58.319 33.333 0.0 0.0 0.0 3.36 F
1266 1365 3.816090 ACCACCACCACCACCACC 61.816 66.667 0.0 0.0 0.0 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1729 3389 1.813786 GAGTTAGTGCACTCGACTCCT 59.186 52.381 32.81 19.31 35.23 3.69 R
2683 4376 7.770897 AGAAACGCATCCATAAATACTCTTCTT 59.229 33.333 0.00 0.00 0.00 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
774 826 8.680903 CATGCAAACTAACAATCTAATCTCCTT 58.319 33.333 0.00 0.0 0.00 3.36
1266 1365 3.816090 ACCACCACCACCACCACC 61.816 66.667 0.00 0.0 0.00 4.61
1630 3290 7.063191 GGTTACTTTCTCTTTCAGGATACGTTC 59.937 40.741 0.00 0.0 46.39 3.95
1632 3292 5.927115 ACTTTCTCTTTCAGGATACGTTCAC 59.073 40.000 0.00 0.0 46.39 3.18
1687 3347 7.308049 CCATGACGAATTCTATCTCTCTTACGA 60.308 40.741 3.52 0.0 0.00 3.43
1729 3389 1.068954 TGCGCGATACAATGCAAACAA 60.069 42.857 12.10 0.0 33.80 2.83
2035 3695 8.391106 AGCAAAACATATCGAAGAATACAAGTC 58.609 33.333 0.00 0.0 43.58 3.01
2683 4376 3.695830 AATAGTCCCAACAAAGAGCGA 57.304 42.857 0.00 0.0 0.00 4.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
784 838 9.582431 GTAGCTACATGTCAAACAACTCTATTA 57.418 33.333 19.15 0.00 0.00 0.98
1523 3183 5.723405 TGATGCATGGAGGAGCTATATAAGT 59.277 40.000 2.46 0.00 0.00 2.24
1630 3290 5.332581 CGCATCTCGTTTACCATATCAAGTG 60.333 44.000 0.00 0.00 0.00 3.16
1632 3292 4.982295 TCGCATCTCGTTTACCATATCAAG 59.018 41.667 0.00 0.00 39.67 3.02
1705 3365 2.103898 TGCATTGTATCGCGCAAATC 57.896 45.000 8.75 0.00 0.00 2.17
1729 3389 1.813786 GAGTTAGTGCACTCGACTCCT 59.186 52.381 32.81 19.31 35.23 3.69
2035 3695 2.584418 CGCGGATGCAGTCAGGAG 60.584 66.667 0.00 0.00 42.97 3.69
2683 4376 7.770897 AGAAACGCATCCATAAATACTCTTCTT 59.229 33.333 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.