Multiple sequence alignment - TraesCS4A01G380000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G380000 chr4A 100.000 3651 0 0 1 3651 657366531 657370181 0.000000e+00 6743
1 TraesCS4A01G380000 chr4A 98.632 3655 44 5 1 3651 657306836 657310488 0.000000e+00 6468
2 TraesCS4A01G380000 chr4A 90.210 3044 237 29 534 3547 649007113 649010125 0.000000e+00 3914
3 TraesCS4A01G380000 chr4A 94.102 729 34 6 2926 3651 649175927 649176649 0.000000e+00 1099
4 TraesCS4A01G380000 chr4A 91.529 484 38 3 2846 3327 649157021 649157503 0.000000e+00 664
5 TraesCS4A01G380000 chr4A 91.322 484 39 3 2846 3327 649117619 649118101 0.000000e+00 658
6 TraesCS4A01G380000 chr4A 89.498 438 31 8 3222 3645 649195951 649196387 1.150000e-149 540
7 TraesCS4A01G380000 chr7B 96.830 3659 107 8 1 3651 2564617 2560960 0.000000e+00 6106
8 TraesCS4A01G380000 chr7D 91.265 3629 254 31 1 3576 42212186 42215804 0.000000e+00 4887
9 TraesCS4A01G380000 chr7D 92.561 3253 207 24 1 3230 42084837 42081597 0.000000e+00 4634
10 TraesCS4A01G380000 chr7D 93.312 3110 169 21 555 3651 42246216 42249299 0.000000e+00 4554
11 TraesCS4A01G380000 chr7D 91.916 3105 221 22 1 3086 41917447 41914354 0.000000e+00 4316
12 TraesCS4A01G380000 chr7D 88.281 512 49 3 1 509 42245566 42246069 1.450000e-168 603
13 TraesCS4A01G380000 chr7D 89.116 441 32 11 3222 3648 42435549 42435987 5.370000e-148 534
14 TraesCS4A01G380000 chr7D 83.806 599 46 17 3084 3648 41875289 41874708 4.180000e-144 521
15 TraesCS4A01G380000 chr7A 89.382 3560 287 43 46 3536 41618775 41622312 0.000000e+00 4396
16 TraesCS4A01G380000 chr7A 86.937 444 30 8 3222 3648 41791230 41791662 1.190000e-129 473
17 TraesCS4A01G380000 chr7A 93.960 149 7 1 1 147 41625750 41625898 1.320000e-54 224
18 TraesCS4A01G380000 chr2B 90.621 3156 261 24 1 3126 783889660 783886510 0.000000e+00 4156
19 TraesCS4A01G380000 chrUn 91.418 2750 197 19 483 3205 250935696 250932959 0.000000e+00 3735


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G380000 chr4A 657366531 657370181 3650 False 6743.0 6743 100.0000 1 3651 1 chr4A.!!$F7 3650
1 TraesCS4A01G380000 chr4A 657306836 657310488 3652 False 6468.0 6468 98.6320 1 3651 1 chr4A.!!$F6 3650
2 TraesCS4A01G380000 chr4A 649007113 649010125 3012 False 3914.0 3914 90.2100 534 3547 1 chr4A.!!$F1 3013
3 TraesCS4A01G380000 chr4A 649175927 649176649 722 False 1099.0 1099 94.1020 2926 3651 1 chr4A.!!$F4 725
4 TraesCS4A01G380000 chr7B 2560960 2564617 3657 True 6106.0 6106 96.8300 1 3651 1 chr7B.!!$R1 3650
5 TraesCS4A01G380000 chr7D 42212186 42215804 3618 False 4887.0 4887 91.2650 1 3576 1 chr7D.!!$F1 3575
6 TraesCS4A01G380000 chr7D 42081597 42084837 3240 True 4634.0 4634 92.5610 1 3230 1 chr7D.!!$R3 3229
7 TraesCS4A01G380000 chr7D 41914354 41917447 3093 True 4316.0 4316 91.9160 1 3086 1 chr7D.!!$R2 3085
8 TraesCS4A01G380000 chr7D 42245566 42249299 3733 False 2578.5 4554 90.7965 1 3651 2 chr7D.!!$F3 3650
9 TraesCS4A01G380000 chr7D 41874708 41875289 581 True 521.0 521 83.8060 3084 3648 1 chr7D.!!$R1 564
10 TraesCS4A01G380000 chr7A 41618775 41625898 7123 False 2310.0 4396 91.6710 1 3536 2 chr7A.!!$F2 3535
11 TraesCS4A01G380000 chr2B 783886510 783889660 3150 True 4156.0 4156 90.6210 1 3126 1 chr2B.!!$R1 3125
12 TraesCS4A01G380000 chrUn 250932959 250935696 2737 True 3735.0 3735 91.4180 483 3205 1 chrUn.!!$R1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
380 384 0.396811 CGGAAGGAAGGTTGACTGGT 59.603 55.0 0.0 0.0 0.0 4.00 F
1500 1624 0.801251 CAAGCTACAAGTCAGGCAGC 59.199 55.0 0.0 0.0 0.0 5.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1499 1623 6.366877 CCAATACATTATGCCAAAATAGCTGC 59.633 38.462 0.0 0.0 0.00 5.25 R
2766 2906 2.664402 AGGATTGGTGCAGAACAACT 57.336 45.000 0.0 0.0 36.69 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 70 6.352565 CCCAGATCTCAAAAAGATGAGGTAGT 60.353 42.308 0.00 0.0 45.06 2.73
380 384 0.396811 CGGAAGGAAGGTTGACTGGT 59.603 55.000 0.00 0.0 0.00 4.00
1499 1623 2.344950 CTCAAGCTACAAGTCAGGCAG 58.655 52.381 0.00 0.0 0.00 4.85
1500 1624 0.801251 CAAGCTACAAGTCAGGCAGC 59.199 55.000 0.00 0.0 0.00 5.25
2380 2517 8.849168 CACATCAAATATATGGCTCAAGGTAAA 58.151 33.333 0.00 0.0 0.00 2.01
2521 2661 3.960102 GGTTGCCCATCAAAGAATATCCA 59.040 43.478 0.00 0.0 36.26 3.41
2806 2946 3.788227 AGGATGTCCACTAAGTTGCAA 57.212 42.857 0.00 0.0 38.89 4.08
2807 2947 4.307032 AGGATGTCCACTAAGTTGCAAT 57.693 40.909 0.59 0.0 38.89 3.56
3168 3353 6.594788 ATTTACACATGCAAAAGTCATCCT 57.405 33.333 0.00 0.0 0.00 3.24
3543 3794 3.679824 ACCTTCTTAGAACCACCTTCG 57.320 47.619 0.00 0.0 33.60 3.79
3633 3885 3.196685 AGGAGAATGAAGTGTACCTCAGC 59.803 47.826 0.00 0.0 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
380 384 4.084287 ACTTGTAGACTAACCCGTCATCA 58.916 43.478 0.00 0.00 36.38 3.07
1499 1623 6.366877 CCAATACATTATGCCAAAATAGCTGC 59.633 38.462 0.00 0.00 0.00 5.25
1500 1624 7.436118 ACCAATACATTATGCCAAAATAGCTG 58.564 34.615 0.00 0.00 0.00 4.24
2521 2661 6.240145 CCCATTTTCACCTTTCCAATGATTT 58.760 36.000 0.00 0.00 0.00 2.17
2766 2906 2.664402 AGGATTGGTGCAGAACAACT 57.336 45.000 0.00 0.00 36.69 3.16
3168 3353 7.920151 CCTTGTTGTTAAACATCATGTTCAAGA 59.080 33.333 20.89 10.88 45.54 3.02
3281 3467 6.135290 ACTACAACTACTCGTGTGTGTTTA 57.865 37.500 0.00 2.06 0.00 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.