Multiple sequence alignment - TraesCS4A01G379900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G379900 chr4A 100.000 3652 0 0 1 3652 657306837 657310488 0.000000e+00 6745
1 TraesCS4A01G379900 chr4A 98.632 3654 44 5 1 3652 657366532 657370181 0.000000e+00 6466
2 TraesCS4A01G379900 chr4A 91.043 2713 217 21 515 3208 649184162 649186867 0.000000e+00 3640
3 TraesCS4A01G379900 chr4A 94.239 729 31 8 2929 3652 649175927 649176649 0.000000e+00 1103
4 TraesCS4A01G379900 chr4A 91.975 486 35 4 2847 3330 649157020 649157503 0.000000e+00 678
5 TraesCS4A01G379900 chr4A 91.770 486 36 4 2847 3330 649117618 649118101 0.000000e+00 673
6 TraesCS4A01G379900 chr4A 89.954 438 27 9 3225 3646 649195951 649196387 1.920000e-152 549
7 TraesCS4A01G379900 chr7B 96.693 3659 112 7 1 3652 2564616 2560960 0.000000e+00 6078
8 TraesCS4A01G379900 chr7D 90.784 3700 265 32 1 3649 42212187 42215861 0.000000e+00 4874
9 TraesCS4A01G379900 chr7D 92.468 3253 212 21 1 3233 42084836 42081597 0.000000e+00 4619
10 TraesCS4A01G379900 chr7D 93.185 3111 172 20 555 3652 42246216 42249299 0.000000e+00 4534
11 TraesCS4A01G379900 chr7D 91.723 3105 229 17 1 3089 41917446 41914354 0.000000e+00 4285
12 TraesCS4A01G379900 chr7D 88.650 511 48 3 1 509 42245567 42246069 6.700000e-172 614
13 TraesCS4A01G379900 chr7D 89.569 441 28 12 3225 3649 42435549 42435987 8.920000e-151 544
14 TraesCS4A01G379900 chr7D 84.140 599 42 18 3087 3649 41875289 41874708 6.940000e-147 531
15 TraesCS4A01G379900 chr7A 89.273 3561 291 45 45 3537 41618775 41622312 0.000000e+00 4375
16 TraesCS4A01G379900 chr7A 87.387 444 26 9 3225 3649 41791230 41791662 1.970000e-132 483
17 TraesCS4A01G379900 chr7A 94.595 148 7 1 1 147 41625751 41625898 1.020000e-55 228
18 TraesCS4A01G379900 chr2B 90.561 3157 263 25 1 3129 783889659 783886510 0.000000e+00 4146
19 TraesCS4A01G379900 chr2B 87.768 981 101 13 1 967 784346504 784347479 0.000000e+00 1129
20 TraesCS4A01G379900 chrUn 91.312 2751 201 21 483 3208 250935696 250932959 0.000000e+00 3722
21 TraesCS4A01G379900 chrUn 84.470 264 22 7 3401 3649 250930290 250930031 3.640000e-60 243
22 TraesCS4A01G379900 chrUn 84.470 264 22 7 3401 3649 283093503 283093762 3.640000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G379900 chr4A 657306837 657310488 3651 False 6745.0 6745 100.0000 1 3652 1 chr4A.!!$F6 3651
1 TraesCS4A01G379900 chr4A 657366532 657370181 3649 False 6466.0 6466 98.6320 1 3652 1 chr4A.!!$F7 3651
2 TraesCS4A01G379900 chr4A 649184162 649186867 2705 False 3640.0 3640 91.0430 515 3208 1 chr4A.!!$F4 2693
3 TraesCS4A01G379900 chr4A 649175927 649176649 722 False 1103.0 1103 94.2390 2929 3652 1 chr4A.!!$F3 723
4 TraesCS4A01G379900 chr7B 2560960 2564616 3656 True 6078.0 6078 96.6930 1 3652 1 chr7B.!!$R1 3651
5 TraesCS4A01G379900 chr7D 42212187 42215861 3674 False 4874.0 4874 90.7840 1 3649 1 chr7D.!!$F1 3648
6 TraesCS4A01G379900 chr7D 42081597 42084836 3239 True 4619.0 4619 92.4680 1 3233 1 chr7D.!!$R3 3232
7 TraesCS4A01G379900 chr7D 41914354 41917446 3092 True 4285.0 4285 91.7230 1 3089 1 chr7D.!!$R2 3088
8 TraesCS4A01G379900 chr7D 42245567 42249299 3732 False 2574.0 4534 90.9175 1 3652 2 chr7D.!!$F3 3651
9 TraesCS4A01G379900 chr7D 41874708 41875289 581 True 531.0 531 84.1400 3087 3649 1 chr7D.!!$R1 562
10 TraesCS4A01G379900 chr7A 41618775 41625898 7123 False 2301.5 4375 91.9340 1 3537 2 chr7A.!!$F2 3536
11 TraesCS4A01G379900 chr2B 783886510 783889659 3149 True 4146.0 4146 90.5610 1 3129 1 chr2B.!!$R1 3128
12 TraesCS4A01G379900 chr2B 784346504 784347479 975 False 1129.0 1129 87.7680 1 967 1 chr2B.!!$F1 966
13 TraesCS4A01G379900 chrUn 250930031 250935696 5665 True 1982.5 3722 87.8910 483 3649 2 chrUn.!!$R1 3166

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
169 172 1.817911 TACCGTGCCGACAATGACCA 61.818 55.000 0.0 0.0 0.00 4.02 F
845 972 7.449704 ACCAGGATAAGGCATCAATAAATCTTC 59.550 37.037 0.0 0.0 35.11 2.87 F
1157 1289 1.604755 CTACGATCGCCTCAAGCTACT 59.395 52.381 16.6 0.0 40.39 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1052 1184 0.255604 TTGGCTAAGGCATGCTGCTA 59.744 50.000 18.92 11.89 44.28 3.49 R
2111 2248 3.181487 GCCAACATCAATAACAGCGGATT 60.181 43.478 0.00 0.00 0.00 3.01 R
2697 2836 3.634397 TCTTGTTTAGGAGCCCATCAG 57.366 47.619 0.00 0.00 0.00 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
169 172 1.817911 TACCGTGCCGACAATGACCA 61.818 55.000 0.00 0.00 0.00 4.02
845 972 7.449704 ACCAGGATAAGGCATCAATAAATCTTC 59.550 37.037 0.00 0.00 35.11 2.87
1157 1289 1.604755 CTACGATCGCCTCAAGCTACT 59.395 52.381 16.60 0.00 40.39 2.57
1442 1574 4.351704 TGCAGAGAATATTCCCATGATCCA 59.648 41.667 11.92 0.73 0.00 3.41
1491 1623 3.776969 TCATCCACTCCTCAAGCTACAAT 59.223 43.478 0.00 0.00 0.00 2.71
1590 1722 4.353325 GCCCATGGTGCCAATACA 57.647 55.556 11.73 0.00 0.00 2.29
1926 2063 4.494350 AGAGATGTGACATGTTTTGTGC 57.506 40.909 1.23 0.00 39.18 4.57
2111 2248 0.250295 CTCAAGTCAGAAACCGGCCA 60.250 55.000 0.00 0.00 0.00 5.36
2376 2513 4.831155 AGCACAGCAAATATATGGCTCAAT 59.169 37.500 8.73 0.00 35.27 2.57
2599 2738 2.505407 TGGCTGGTATTGCAGTAGATGT 59.495 45.455 0.00 0.00 0.00 3.06
2697 2836 2.162408 GCTACAACTCAATGCCTTCCAC 59.838 50.000 0.00 0.00 0.00 4.02
2779 2918 1.959085 CTTGCGGGTTGTTCTGCAT 59.041 52.632 0.00 0.00 46.85 3.96
3404 6149 7.405292 TGAAATGAATGATAACAAGGTCTCCT 58.595 34.615 0.00 0.00 33.87 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
169 172 5.356470 GCATGTTTTGAGAATAAGCTCCTCT 59.644 40.000 0.00 0.00 33.95 3.69
641 763 8.268850 TCTCTTTAGAATTTCTTTCCATTCGG 57.731 34.615 3.86 0.00 34.99 4.30
1052 1184 0.255604 TTGGCTAAGGCATGCTGCTA 59.744 50.000 18.92 11.89 44.28 3.49
1157 1289 3.879295 CTCACAGAACTCCTTTGCAAGAA 59.121 43.478 0.00 0.00 0.00 2.52
1376 1508 5.163513 CAACAAGAAACTTTGCTGTGAACT 58.836 37.500 0.00 0.00 0.00 3.01
1442 1574 1.164041 CGGGAAACTTTGCAGTCCGT 61.164 55.000 0.00 0.00 34.61 4.69
1491 1623 2.493278 GCCAAAATAGCTCTTGCCTGAA 59.507 45.455 0.00 0.00 40.80 3.02
1590 1722 4.253685 CCGGGCTTCGTATAATGATTGAT 58.746 43.478 0.00 0.00 37.11 2.57
1926 2063 6.750501 CCTTTGTCATTACATGAATCTGCAAG 59.249 38.462 0.00 0.00 41.69 4.01
2111 2248 3.181487 GCCAACATCAATAACAGCGGATT 60.181 43.478 0.00 0.00 0.00 3.01
2599 2738 3.885724 TGTCACTGGCGATATTCTTGA 57.114 42.857 0.00 0.00 0.00 3.02
2697 2836 3.634397 TCTTGTTTAGGAGCCCATCAG 57.366 47.619 0.00 0.00 0.00 2.90
2779 2918 5.529289 ACTTAGTGGACATCCTAGGATTGA 58.471 41.667 22.29 2.47 36.82 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.