Multiple sequence alignment - TraesCS4A01G374900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G374900 chr4A 100.000 2497 0 0 1 2497 649747304 649744808 0.000000e+00 4612
1 TraesCS4A01G374900 chr4A 99.119 2498 20 2 1 2497 649712443 649709947 0.000000e+00 4490
2 TraesCS4A01G374900 chr4A 98.840 2499 27 2 1 2497 649676799 649674301 0.000000e+00 4453
3 TraesCS4A01G374900 chr4D 89.406 1718 146 20 439 2128 474416865 474415156 0.000000e+00 2132
4 TraesCS4A01G374900 chr2B 84.903 1709 196 36 436 2128 116477346 116479008 0.000000e+00 1670
5 TraesCS4A01G374900 chr2B 92.560 336 21 2 2164 2497 116479007 116479340 1.740000e-131 479
6 TraesCS4A01G374900 chr2D 86.662 1492 158 23 442 1903 141811246 141812726 0.000000e+00 1615
7 TraesCS4A01G374900 chr2D 86.379 1483 154 32 442 1889 352879359 352880828 0.000000e+00 1576
8 TraesCS4A01G374900 chr2D 95.925 319 11 1 2181 2497 352881056 352881374 1.320000e-142 516
9 TraesCS4A01G374900 chr2D 95.611 319 12 1 2181 2497 141812939 141813257 6.160000e-141 510
10 TraesCS4A01G374900 chr1D 86.501 1489 149 36 451 1901 414577777 414576303 0.000000e+00 1589
11 TraesCS4A01G374900 chr1D 94.671 319 12 2 2181 2497 414576088 414575773 8.030000e-135 490
12 TraesCS4A01G374900 chr3D 87.155 1378 134 28 442 1792 447547981 447546620 0.000000e+00 1524
13 TraesCS4A01G374900 chr3D 95.238 336 14 1 2164 2497 447539067 447538732 4.730000e-147 531
14 TraesCS4A01G374900 chr3D 82.412 199 31 4 1934 2128 447539264 447539066 1.190000e-38 171
15 TraesCS4A01G374900 chr7A 86.048 1412 152 32 513 1884 94856277 94857683 0.000000e+00 1474
16 TraesCS4A01G374900 chr7A 95.611 319 12 1 2181 2497 94857916 94858234 6.160000e-141 510
17 TraesCS4A01G374900 chr6A 85.654 1429 162 34 513 1901 564656111 564654686 0.000000e+00 1463
18 TraesCS4A01G374900 chr6A 94.984 319 14 1 2181 2497 564654471 564654153 1.330000e-137 499
19 TraesCS4A01G374900 chr6A 82.759 203 25 8 1933 2128 564654687 564654488 3.300000e-39 172
20 TraesCS4A01G374900 chr5D 91.803 976 75 4 439 1411 44456239 44457212 0.000000e+00 1354
21 TraesCS4A01G374900 chr5D 84.615 156 10 8 283 428 44454668 44454819 2.590000e-30 143
22 TraesCS4A01G374900 chr1A 83.495 309 35 11 144 450 344114878 344114584 8.800000e-70 274
23 TraesCS4A01G374900 chr6B 85.714 140 13 5 301 439 64971020 64971153 9.310000e-30 141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G374900 chr4A 649744808 649747304 2496 True 4612.000000 4612 100.0000 1 2497 1 chr4A.!!$R3 2496
1 TraesCS4A01G374900 chr4A 649709947 649712443 2496 True 4490.000000 4490 99.1190 1 2497 1 chr4A.!!$R2 2496
2 TraesCS4A01G374900 chr4A 649674301 649676799 2498 True 4453.000000 4453 98.8400 1 2497 1 chr4A.!!$R1 2496
3 TraesCS4A01G374900 chr4D 474415156 474416865 1709 True 2132.000000 2132 89.4060 439 2128 1 chr4D.!!$R1 1689
4 TraesCS4A01G374900 chr2B 116477346 116479340 1994 False 1074.500000 1670 88.7315 436 2497 2 chr2B.!!$F1 2061
5 TraesCS4A01G374900 chr2D 141811246 141813257 2011 False 1062.500000 1615 91.1365 442 2497 2 chr2D.!!$F1 2055
6 TraesCS4A01G374900 chr2D 352879359 352881374 2015 False 1046.000000 1576 91.1520 442 2497 2 chr2D.!!$F2 2055
7 TraesCS4A01G374900 chr1D 414575773 414577777 2004 True 1039.500000 1589 90.5860 451 2497 2 chr1D.!!$R1 2046
8 TraesCS4A01G374900 chr3D 447546620 447547981 1361 True 1524.000000 1524 87.1550 442 1792 1 chr3D.!!$R1 1350
9 TraesCS4A01G374900 chr3D 447538732 447539264 532 True 351.000000 531 88.8250 1934 2497 2 chr3D.!!$R2 563
10 TraesCS4A01G374900 chr7A 94856277 94858234 1957 False 992.000000 1474 90.8295 513 2497 2 chr7A.!!$F1 1984
11 TraesCS4A01G374900 chr6A 564654153 564656111 1958 True 711.333333 1463 87.7990 513 2497 3 chr6A.!!$R1 1984
12 TraesCS4A01G374900 chr5D 44454668 44457212 2544 False 748.500000 1354 88.2090 283 1411 2 chr5D.!!$F1 1128

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
583 1723 1.065126 ACCAGAGGAAGTTATGCCAGC 60.065 52.381 0.0 0.0 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1541 2690 6.659242 ACACTAAACGAAAGGGATTGAATCAT 59.341 34.615 7.56 0.0 0.0 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
534 1669 5.543507 TTTTCCTGGTGTAAAATGTGCAT 57.456 34.783 0.00 0.00 0.00 3.96
583 1723 1.065126 ACCAGAGGAAGTTATGCCAGC 60.065 52.381 0.00 0.00 0.00 4.85
936 2079 4.998672 CCTTACGTTGGTATGAGGTTTGAA 59.001 41.667 0.00 0.00 0.00 2.69
937 2080 5.646360 CCTTACGTTGGTATGAGGTTTGAAT 59.354 40.000 0.00 0.00 0.00 2.57
1057 2200 6.091441 TGTGTTGGTAAAGCAACAATTTGTTC 59.909 34.615 24.52 13.48 38.77 3.18
1506 2653 5.626955 GTGCTTGTCTGCTGATCTTTTTAAC 59.373 40.000 0.00 0.00 0.00 2.01
1516 2663 9.713740 CTGCTGATCTTTTTAACTGTGATATTC 57.286 33.333 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
534 1669 8.578448 TCATTCAGGTCAATCATATTCAAACA 57.422 30.769 0.00 0.0 0.00 2.83
583 1723 3.077229 TGTCATGAACAAAGGCAAACG 57.923 42.857 0.00 0.0 34.03 3.60
936 2079 5.535030 GTGTTCCTTTACACCTTCCAAAGAT 59.465 40.000 0.00 0.0 41.99 2.40
937 2080 4.885325 GTGTTCCTTTACACCTTCCAAAGA 59.115 41.667 0.00 0.0 41.99 2.52
1057 2200 3.420839 AGGTTTCTGAAACTTGTTGCG 57.579 42.857 26.93 0.0 41.14 4.85
1089 2233 1.075659 GGGCTTTTCTGCACCTCCT 59.924 57.895 0.00 0.0 34.04 3.69
1541 2690 6.659242 ACACTAAACGAAAGGGATTGAATCAT 59.341 34.615 7.56 0.0 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.