Multiple sequence alignment - TraesCS4A01G365100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G365100 chr4A 100.000 2775 0 0 1 2775 638242099 638239325 0.000000e+00 5125.0
1 TraesCS4A01G365100 chr4A 91.057 123 11 0 2516 2638 735595628 735595750 1.710000e-37 167.0
2 TraesCS4A01G365100 chr5B 99.459 2775 13 2 1 2775 407323106 407320334 0.000000e+00 5040.0
3 TraesCS4A01G365100 chr1D 92.622 1762 92 23 733 2477 468030563 468032303 0.000000e+00 2499.0
4 TraesCS4A01G365100 chr1D 88.333 780 68 18 733 1492 142151420 142150644 0.000000e+00 915.0
5 TraesCS4A01G365100 chr1D 93.436 259 15 2 462 719 468030249 468030506 1.560000e-102 383.0
6 TraesCS4A01G365100 chr1D 95.122 123 6 0 2516 2638 468032378 468032500 7.840000e-46 195.0
7 TraesCS4A01G365100 chr1D 90.909 143 11 1 2635 2775 468032663 468032805 1.010000e-44 191.0
8 TraesCS4A01G365100 chr5A 94.173 1064 42 12 791 1836 473425987 473427048 0.000000e+00 1604.0
9 TraesCS4A01G365100 chr1B 94.173 1064 42 12 791 1836 590412997 590411936 0.000000e+00 1604.0
10 TraesCS4A01G365100 chr1B 88.205 780 68 18 733 1492 191002692 191003467 0.000000e+00 909.0
11 TraesCS4A01G365100 chr1B 86.624 157 19 1 565 719 191002477 191002633 3.670000e-39 172.0
12 TraesCS4A01G365100 chr7B 90.188 1172 85 19 734 1885 210629803 210628642 0.000000e+00 1500.0
13 TraesCS4A01G365100 chr7B 89.091 605 54 6 117 719 210630451 210629857 0.000000e+00 741.0
14 TraesCS4A01G365100 chr7B 89.610 77 8 0 197 273 102761604 102761528 6.330000e-17 99.0
15 TraesCS4A01G365100 chr2A 88.068 947 88 13 775 1715 448555055 448554128 0.000000e+00 1099.0
16 TraesCS4A01G365100 chr2A 89.415 718 56 11 1775 2477 448553996 448553284 0.000000e+00 887.0
17 TraesCS4A01G365100 chr3D 87.924 944 87 16 775 1712 335212943 335213865 0.000000e+00 1086.0
18 TraesCS4A01G365100 chr3D 90.111 718 53 7 1775 2477 335214000 335214714 0.000000e+00 917.0
19 TraesCS4A01G365100 chr3D 80.088 452 78 10 2035 2477 49638752 49639200 2.670000e-85 326.0
20 TraesCS4A01G365100 chr3D 92.683 123 9 0 2516 2638 335214789 335214911 7.900000e-41 178.0
21 TraesCS4A01G365100 chr5D 87.394 944 94 16 775 1712 69675402 69676326 0.000000e+00 1061.0
22 TraesCS4A01G365100 chr5D 89.833 718 57 6 1775 2477 69676461 69677177 0.000000e+00 907.0
23 TraesCS4A01G365100 chr5D 94.309 123 7 0 2516 2638 69677252 69677374 3.650000e-44 189.0
24 TraesCS4A01G365100 chr5D 84.810 79 12 0 332 410 484658197 484658119 2.290000e-11 80.5
25 TraesCS4A01G365100 chr1A 86.653 944 101 13 775 1712 163095322 163096246 0.000000e+00 1022.0
26 TraesCS4A01G365100 chr1A 88.103 622 53 15 733 1336 148268033 148268651 0.000000e+00 719.0
27 TraesCS4A01G365100 chr1A 88.752 569 54 5 1918 2477 163096287 163096854 0.000000e+00 688.0
28 TraesCS4A01G365100 chr1A 94.309 123 7 0 2516 2638 163096928 163097050 3.650000e-44 189.0
29 TraesCS4A01G365100 chr1A 87.261 157 18 1 565 719 148267818 148267974 7.900000e-41 178.0
30 TraesCS4A01G365100 chr7D 89.694 718 56 8 1775 2477 573798823 573799537 0.000000e+00 900.0
31 TraesCS4A01G365100 chr7D 93.496 123 8 0 2516 2638 573799611 573799733 1.700000e-42 183.0
32 TraesCS4A01G365100 chrUn 100.000 450 0 0 2212 2661 475764912 475764463 0.000000e+00 832.0
33 TraesCS4A01G365100 chrUn 92.601 419 15 11 818 1222 477073136 477072720 3.080000e-164 588.0
34 TraesCS4A01G365100 chr3A 80.488 451 75 11 2035 2475 63066330 63066777 1.590000e-87 333.0
35 TraesCS4A01G365100 chr2B 91.667 120 10 0 2519 2638 12183320 12183201 1.710000e-37 167.0
36 TraesCS4A01G365100 chr2D 75.728 412 44 27 117 523 643804730 643805090 3.700000e-34 156.0
37 TraesCS4A01G365100 chr6B 90.909 77 7 0 197 273 623363440 623363364 1.360000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G365100 chr4A 638239325 638242099 2774 True 5125.0 5125 100.000000 1 2775 1 chr4A.!!$R1 2774
1 TraesCS4A01G365100 chr5B 407320334 407323106 2772 True 5040.0 5040 99.459000 1 2775 1 chr5B.!!$R1 2774
2 TraesCS4A01G365100 chr1D 142150644 142151420 776 True 915.0 915 88.333000 733 1492 1 chr1D.!!$R1 759
3 TraesCS4A01G365100 chr1D 468030249 468032805 2556 False 817.0 2499 93.022250 462 2775 4 chr1D.!!$F1 2313
4 TraesCS4A01G365100 chr5A 473425987 473427048 1061 False 1604.0 1604 94.173000 791 1836 1 chr5A.!!$F1 1045
5 TraesCS4A01G365100 chr1B 590411936 590412997 1061 True 1604.0 1604 94.173000 791 1836 1 chr1B.!!$R1 1045
6 TraesCS4A01G365100 chr1B 191002477 191003467 990 False 540.5 909 87.414500 565 1492 2 chr1B.!!$F1 927
7 TraesCS4A01G365100 chr7B 210628642 210630451 1809 True 1120.5 1500 89.639500 117 1885 2 chr7B.!!$R2 1768
8 TraesCS4A01G365100 chr2A 448553284 448555055 1771 True 993.0 1099 88.741500 775 2477 2 chr2A.!!$R1 1702
9 TraesCS4A01G365100 chr3D 335212943 335214911 1968 False 727.0 1086 90.239333 775 2638 3 chr3D.!!$F2 1863
10 TraesCS4A01G365100 chr5D 69675402 69677374 1972 False 719.0 1061 90.512000 775 2638 3 chr5D.!!$F1 1863
11 TraesCS4A01G365100 chr1A 163095322 163097050 1728 False 633.0 1022 89.904667 775 2638 3 chr1A.!!$F2 1863
12 TraesCS4A01G365100 chr1A 148267818 148268651 833 False 448.5 719 87.682000 565 1336 2 chr1A.!!$F1 771
13 TraesCS4A01G365100 chr7D 573798823 573799733 910 False 541.5 900 91.595000 1775 2638 2 chr7D.!!$F1 863

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
405 408 0.250727 CGCCCTTGAGTTGGAGGAAA 60.251 55.0 0.0 0.0 34.91 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2153 2321 7.667043 TCATTTAGTACAACACAATCTCACC 57.333 36.0 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 1.368641 TCTCGCATGATTTTGACCGG 58.631 50.000 0.0 0.00 0.00 5.28
95 96 3.594775 CCAACGCCAACAGCAGCA 61.595 61.111 0.0 0.00 44.04 4.41
405 408 0.250727 CGCCCTTGAGTTGGAGGAAA 60.251 55.000 0.0 0.00 34.91 3.13
1052 1126 0.461961 ACCGCAAGTAGAGATGAGCC 59.538 55.000 0.0 0.00 0.00 4.70
1896 2059 6.359804 TGGAGCATCTATAGACTTGCATTTT 58.640 36.000 23.7 8.66 33.69 1.82
2153 2321 3.685139 TGTTGAGCAGAAGGAGTTAGG 57.315 47.619 0.0 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 2.743928 CTGTTGAGGTGAGGCGCC 60.744 66.667 21.89 21.89 0.00 6.53
95 96 3.506787 CCTTCCCCACCATAGATCCCTAT 60.507 52.174 0.00 0.00 36.06 2.57
405 408 4.379243 CCCGCAAGCTGTCCTCGT 62.379 66.667 0.00 0.00 0.00 4.18
512 515 7.067372 AGAGAGAAGAGAACACATACATCTCAG 59.933 40.741 4.98 0.00 41.60 3.35
1052 1126 4.755123 ACTCCATGACAAGGTTTAGAAACG 59.245 41.667 0.00 0.00 39.77 3.60
1896 2059 8.792633 CATGGAGTAATTAGACTGTTGGAAAAA 58.207 33.333 0.00 0.00 0.00 1.94
2153 2321 7.667043 TCATTTAGTACAACACAATCTCACC 57.333 36.000 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.