Multiple sequence alignment - TraesCS4A01G364100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G364100 chr4A 100.000 2564 0 0 1 2564 637535931 637533368 0.000000e+00 4735
1 TraesCS4A01G364100 chr4A 96.244 1065 16 1 920 1984 637520141 637521181 0.000000e+00 1724
2 TraesCS4A01G364100 chr4A 99.347 919 5 1 1 918 637519174 637520092 0.000000e+00 1663
3 TraesCS4A01G364100 chr4A 99.129 919 7 1 1 918 637429662 637430580 0.000000e+00 1652
4 TraesCS4A01G364100 chr4A 98.592 923 11 2 1 921 637313769 637312847 0.000000e+00 1631
5 TraesCS4A01G364100 chr4A 97.333 900 17 3 1 893 637311928 637312827 0.000000e+00 1522
6 TraesCS4A01G364100 chr4A 99.465 747 4 0 1 747 637450351 637449605 0.000000e+00 1358
7 TraesCS4A01G364100 chr4A 98.077 572 11 0 1991 2562 637285943 637285372 0.000000e+00 996
8 TraesCS4A01G364100 chr4A 97.719 570 13 0 1991 2560 637470851 637470282 0.000000e+00 981
9 TraesCS4A01G364100 chr4A 97.552 572 14 0 1991 2562 637587846 637587275 0.000000e+00 979
10 TraesCS4A01G364100 chr4A 96.503 572 20 0 1991 2562 637383277 637382706 0.000000e+00 946
11 TraesCS4A01G364100 chr4A 94.930 572 14 2 1991 2562 637343522 637342966 0.000000e+00 881
12 TraesCS4A01G364100 chr4A 98.760 484 6 0 2079 2562 637336532 637336049 0.000000e+00 861
13 TraesCS4A01G364100 chr4A 98.681 455 6 0 920 1374 637430629 637431083 0.000000e+00 808
14 TraesCS4A01G364100 chr4A 86.331 278 20 7 70 339 599577123 599577390 1.160000e-73 287
15 TraesCS4A01G364100 chr4A 100.000 74 0 0 1365 1438 637431185 637431112 1.240000e-28 137
16 TraesCS4A01G364100 chr5D 96.503 572 20 0 1991 2562 534546216 534546787 0.000000e+00 946
17 TraesCS4A01G364100 chr5D 98.066 362 7 0 1 362 534390250 534389889 4.660000e-177 630
18 TraesCS4A01G364100 chr5D 87.349 166 18 2 1762 1924 26906338 26906503 1.210000e-43 187
19 TraesCS4A01G364100 chr5D 94.000 100 6 0 2463 2562 534226766 534226865 4.420000e-33 152
20 TraesCS4A01G364100 chr3D 87.479 583 55 3 1991 2562 419444201 419443626 0.000000e+00 656
21 TraesCS4A01G364100 chr3D 88.344 163 17 1 1761 1921 612268448 612268610 7.240000e-46 195
22 TraesCS4A01G364100 chr2D 83.821 581 74 8 1991 2559 614639535 614640107 3.760000e-148 534
23 TraesCS4A01G364100 chr2D 86.982 169 20 1 1755 1921 362930801 362930969 3.370000e-44 189
24 TraesCS4A01G364100 chr2A 93.567 171 9 2 739 907 245782648 245782478 1.180000e-63 254
25 TraesCS4A01G364100 chr2A 87.283 173 14 6 1759 1926 758586574 758586743 9.360000e-45 191
26 TraesCS4A01G364100 chr7B 93.976 166 9 1 739 903 324138714 324138549 1.520000e-62 250
27 TraesCS4A01G364100 chr6A 92.398 171 12 1 739 908 216194060 216194230 2.550000e-60 243
28 TraesCS4A01G364100 chr7A 91.011 178 11 5 741 915 677696246 677696421 4.270000e-58 235
29 TraesCS4A01G364100 chr7A 86.503 163 20 1 1762 1922 498937206 498937368 7.290000e-41 178
30 TraesCS4A01G364100 chrUn 88.205 195 15 7 715 903 96478192 96478384 2.570000e-55 226
31 TraesCS4A01G364100 chrUn 91.892 74 6 0 1640 1713 49596596 49596523 1.250000e-18 104
32 TraesCS4A01G364100 chr4D 87.791 172 18 2 1763 1931 428581052 428580881 5.600000e-47 198
33 TraesCS4A01G364100 chr3A 88.235 170 13 6 1756 1921 53566342 53566508 2.010000e-46 196
34 TraesCS4A01G364100 chr5B 88.750 160 16 1 1759 1916 541684157 541683998 7.240000e-46 195
35 TraesCS4A01G364100 chr5B 85.549 173 22 2 1757 1927 417443920 417444091 7.290000e-41 178
36 TraesCS4A01G364100 chr1B 88.344 163 17 2 1762 1922 121584436 121584274 7.240000e-46 195
37 TraesCS4A01G364100 chr2B 86.982 169 20 2 1756 1922 727714945 727715113 3.370000e-44 189
38 TraesCS4A01G364100 chr6D 85.475 179 21 4 1762 1938 178849199 178849374 5.640000e-42 182
39 TraesCS4A01G364100 chr5A 85.799 169 22 1 1761 1927 685989856 685990024 7.290000e-41 178
40 TraesCS4A01G364100 chr4B 86.503 163 20 1 1762 1922 527317259 527317421 7.290000e-41 178
41 TraesCS4A01G364100 chr4B 86.301 146 20 0 1991 2136 93424346 93424491 2.640000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G364100 chr4A 637533368 637535931 2563 True 4735.0 4735 100.0000 1 2564 1 chr4A.!!$R9 2563
1 TraesCS4A01G364100 chr4A 637519174 637521181 2007 False 1693.5 1724 97.7955 1 1984 2 chr4A.!!$F4 1983
2 TraesCS4A01G364100 chr4A 637312847 637313769 922 True 1631.0 1631 98.5920 1 921 1 chr4A.!!$R2 920
3 TraesCS4A01G364100 chr4A 637311928 637312827 899 False 1522.0 1522 97.3330 1 893 1 chr4A.!!$F2 892
4 TraesCS4A01G364100 chr4A 637449605 637450351 746 True 1358.0 1358 99.4650 1 747 1 chr4A.!!$R7 746
5 TraesCS4A01G364100 chr4A 637429662 637431083 1421 False 1230.0 1652 98.9050 1 1374 2 chr4A.!!$F3 1373
6 TraesCS4A01G364100 chr4A 637285372 637285943 571 True 996.0 996 98.0770 1991 2562 1 chr4A.!!$R1 571
7 TraesCS4A01G364100 chr4A 637470282 637470851 569 True 981.0 981 97.7190 1991 2560 1 chr4A.!!$R8 569
8 TraesCS4A01G364100 chr4A 637587275 637587846 571 True 979.0 979 97.5520 1991 2562 1 chr4A.!!$R10 571
9 TraesCS4A01G364100 chr4A 637382706 637383277 571 True 946.0 946 96.5030 1991 2562 1 chr4A.!!$R5 571
10 TraesCS4A01G364100 chr4A 637342966 637343522 556 True 881.0 881 94.9300 1991 2562 1 chr4A.!!$R4 571
11 TraesCS4A01G364100 chr5D 534546216 534546787 571 False 946.0 946 96.5030 1991 2562 1 chr5D.!!$F3 571
12 TraesCS4A01G364100 chr3D 419443626 419444201 575 True 656.0 656 87.4790 1991 2562 1 chr3D.!!$R1 571
13 TraesCS4A01G364100 chr2D 614639535 614640107 572 False 534.0 534 83.8210 1991 2559 1 chr2D.!!$F2 568

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
713 719 3.128632 TACGTACGCATGAGGGCCG 62.129 63.158 16.72 0.0 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1987 2066 0.250234 CCGGCCAATCTCTCTTGACA 59.75 55.0 2.24 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
713 719 3.128632 TACGTACGCATGAGGGCCG 62.129 63.158 16.72 0.00 0.00 6.13
893 901 8.665643 TCTAAAAAGACTTACATTTCGGAACA 57.334 30.769 0.00 0.00 0.00 3.18
918 926 9.467796 CAGAGGGAGTATTTATTCCTTCTTTTT 57.532 33.333 10.01 0.00 42.99 1.94
1212 1291 4.016706 GGTGCCACTACTGCCGGT 62.017 66.667 1.90 0.00 0.00 5.28
1213 1292 2.742372 GTGCCACTACTGCCGGTG 60.742 66.667 1.90 0.00 0.00 4.94
1214 1293 4.697756 TGCCACTACTGCCGGTGC 62.698 66.667 1.90 0.00 38.26 5.01
1296 1375 2.579873 GACATATGTCAGGCATGCCTT 58.420 47.619 36.92 24.24 46.28 4.35
1297 1376 3.743521 GACATATGTCAGGCATGCCTTA 58.256 45.455 36.92 26.96 46.28 2.69
1549 1628 5.008619 TCGTAACGCCCTTTGTTATATGA 57.991 39.130 0.00 0.00 34.59 2.15
1775 1854 5.105023 GGTAAAATTCTACTCCCTCCGTTCT 60.105 44.000 0.00 0.00 0.00 3.01
1839 1918 4.631813 ACGGAGCAAAATGAGTGAATCTAC 59.368 41.667 0.00 0.00 0.00 2.59
1840 1919 4.259970 CGGAGCAAAATGAGTGAATCTACG 60.260 45.833 0.00 0.00 0.00 3.51
1848 1927 4.471904 TGAGTGAATCTACGCTCCAAAT 57.528 40.909 0.00 0.00 43.94 2.32
1852 1931 4.330074 AGTGAATCTACGCTCCAAATTTCG 59.670 41.667 0.00 0.00 0.00 3.46
1984 2063 0.834687 AAGTCCTCAAGCCCCACGTA 60.835 55.000 0.00 0.00 0.00 3.57
1985 2064 1.079336 GTCCTCAAGCCCCACGTAC 60.079 63.158 0.00 0.00 0.00 3.67
1986 2065 1.534476 TCCTCAAGCCCCACGTACA 60.534 57.895 0.00 0.00 0.00 2.90
1987 2066 0.907704 TCCTCAAGCCCCACGTACAT 60.908 55.000 0.00 0.00 0.00 2.29
1988 2067 0.744414 CCTCAAGCCCCACGTACATG 60.744 60.000 0.00 0.00 0.00 3.21
1989 2068 0.036388 CTCAAGCCCCACGTACATGT 60.036 55.000 2.69 2.69 0.00 3.21
2258 2337 0.179111 TTGTCGATGATCGGGAGCAC 60.179 55.000 15.48 5.85 40.88 4.40
2331 2410 0.178924 GGAATTGGGCTATGGGGCAT 60.179 55.000 0.00 0.00 42.84 4.40
2562 2653 3.066190 CCTAGGTCCACCGCACGA 61.066 66.667 0.00 0.00 42.08 4.35
2563 2654 2.642254 CCTAGGTCCACCGCACGAA 61.642 63.158 0.00 0.00 42.08 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
893 901 9.688091 GAAAAAGAAGGAATAAATACTCCCTCT 57.312 33.333 0.00 0.00 34.55 3.69
918 926 6.275494 TGTTATTCTACTGACGTGAATGGA 57.725 37.500 0.00 0.00 33.24 3.41
1839 1918 7.201444 GGATGTATATAGACGAAATTTGGAGCG 60.201 40.741 7.24 1.35 0.00 5.03
1840 1919 7.201444 CGGATGTATATAGACGAAATTTGGAGC 60.201 40.741 7.24 0.00 0.00 4.70
1984 2063 2.679059 CGGCCAATCTCTCTTGACATGT 60.679 50.000 2.24 0.00 0.00 3.21
1985 2064 1.938577 CGGCCAATCTCTCTTGACATG 59.061 52.381 2.24 0.00 0.00 3.21
1986 2065 1.134280 CCGGCCAATCTCTCTTGACAT 60.134 52.381 2.24 0.00 0.00 3.06
1987 2066 0.250234 CCGGCCAATCTCTCTTGACA 59.750 55.000 2.24 0.00 0.00 3.58
1988 2067 1.092345 GCCGGCCAATCTCTCTTGAC 61.092 60.000 18.11 0.00 0.00 3.18
1989 2068 1.221840 GCCGGCCAATCTCTCTTGA 59.778 57.895 18.11 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.