Multiple sequence alignment - TraesCS4A01G360500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G360500 chr4A 100.000 2486 0 0 1 2486 633467260 633469745 0.000000e+00 4591
1 TraesCS4A01G360500 chr4A 99.076 2489 19 1 2 2486 633508735 633511223 0.000000e+00 4466
2 TraesCS4A01G360500 chr4A 98.673 2487 29 3 1 2486 633533379 633535862 0.000000e+00 4407
3 TraesCS4A01G360500 chr4A 98.069 2486 47 1 1 2486 633685853 633688337 0.000000e+00 4324
4 TraesCS4A01G360500 chr4A 97.953 2492 44 2 2 2486 633425073 633427564 0.000000e+00 4313
5 TraesCS4A01G360500 chrUn 96.927 2441 68 7 1 2436 282364697 282362259 0.000000e+00 4085
6 TraesCS4A01G360500 chrUn 96.723 2441 73 7 1 2436 86510013 86507575 0.000000e+00 4058
7 TraesCS4A01G360500 chrUn 98.305 59 1 0 2428 2486 150804224 150804282 1.220000e-18 104
8 TraesCS4A01G360500 chrUn 98.305 59 1 0 2428 2486 165292925 165292983 1.220000e-18 104
9 TraesCS4A01G360500 chrUn 98.305 59 1 0 2428 2486 329284905 329284847 1.220000e-18 104
10 TraesCS4A01G360500 chrUn 98.305 59 1 0 2428 2486 334410668 334410726 1.220000e-18 104
11 TraesCS4A01G360500 chrUn 98.305 59 1 0 2428 2486 342724454 342724396 1.220000e-18 104
12 TraesCS4A01G360500 chr6B 96.847 2442 68 9 1 2436 596620323 596622761 0.000000e+00 4074
13 TraesCS4A01G360500 chr3B 96.477 2441 76 9 1 2436 92317837 92320272 0.000000e+00 4023
14 TraesCS4A01G360500 chr2B 96.475 2440 76 9 1 2436 30670612 30668179 0.000000e+00 4021


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G360500 chr4A 633467260 633469745 2485 False 4591 4591 100.000 1 2486 1 chr4A.!!$F2 2485
1 TraesCS4A01G360500 chr4A 633508735 633511223 2488 False 4466 4466 99.076 2 2486 1 chr4A.!!$F3 2484
2 TraesCS4A01G360500 chr4A 633533379 633535862 2483 False 4407 4407 98.673 1 2486 1 chr4A.!!$F4 2485
3 TraesCS4A01G360500 chr4A 633685853 633688337 2484 False 4324 4324 98.069 1 2486 1 chr4A.!!$F5 2485
4 TraesCS4A01G360500 chr4A 633425073 633427564 2491 False 4313 4313 97.953 2 2486 1 chr4A.!!$F1 2484
5 TraesCS4A01G360500 chrUn 282362259 282364697 2438 True 4085 4085 96.927 1 2436 1 chrUn.!!$R2 2435
6 TraesCS4A01G360500 chrUn 86507575 86510013 2438 True 4058 4058 96.723 1 2436 1 chrUn.!!$R1 2435
7 TraesCS4A01G360500 chr6B 596620323 596622761 2438 False 4074 4074 96.847 1 2436 1 chr6B.!!$F1 2435
8 TraesCS4A01G360500 chr3B 92317837 92320272 2435 False 4023 4023 96.477 1 2436 1 chr3B.!!$F1 2435
9 TraesCS4A01G360500 chr2B 30668179 30670612 2433 True 4021 4021 96.475 1 2436 1 chr2B.!!$R1 2435

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
783 786 3.326588 TCTTCAAAACTTCTCCGGATCCA 59.673 43.478 13.41 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1974 1984 2.57229 AGGCTTGCGAAACAAAGTAGT 58.428 42.857 0.0 0.0 37.96 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
783 786 3.326588 TCTTCAAAACTTCTCCGGATCCA 59.673 43.478 13.41 0.0 0.0 3.41
1044 1047 3.052566 AGAGTCCTGATGTAGTGGGATCA 60.053 47.826 0.00 0.0 0.0 2.92
1789 1799 1.404843 AGGGATAAGAGAGTGTCGGC 58.595 55.000 0.00 0.0 0.0 5.54
1974 1984 9.651913 GTTAATTAAGATTCCATTTCAAAGGCA 57.348 29.630 0.00 0.0 0.0 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1044 1047 5.116882 GCTAGAGGTTGTAACAATCCGAAT 58.883 41.667 0.0 0.0 0.00 3.34
1789 1799 3.146618 AGAATGAAGGCTACGTACACG 57.853 47.619 0.0 0.0 46.33 4.49
1974 1984 2.572290 AGGCTTGCGAAACAAAGTAGT 58.428 42.857 0.0 0.0 37.96 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.