Multiple sequence alignment - TraesCS4A01G360400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G360400 chr4A 100.000 4203 0 0 1 4203 633446667 633450869 0.000000e+00 7762.0
1 TraesCS4A01G360400 chr4A 97.833 3600 73 5 608 4203 633719724 633723322 0.000000e+00 6211.0
2 TraesCS4A01G360400 chr4A 97.907 3154 60 6 1056 4203 633404767 633407920 0.000000e+00 5454.0
3 TraesCS4A01G360400 chr4A 98.246 3022 48 5 1185 4203 633513999 633517018 0.000000e+00 5282.0
4 TraesCS4A01G360400 chr4A 97.810 2922 51 4 1283 4201 633538701 633541612 0.000000e+00 5029.0
5 TraesCS4A01G360400 chr4A 98.939 2167 20 3 2040 4203 633490152 633492318 0.000000e+00 3871.0
6 TraesCS4A01G360400 chr4A 98.093 2202 30 4 2005 4203 633650212 633652404 0.000000e+00 3823.0
7 TraesCS4A01G360400 chr4A 98.250 2114 33 1 1 2110 633487658 633489771 0.000000e+00 3696.0
8 TraesCS4A01G360400 chr4A 97.324 1009 25 2 1185 2193 633472506 633473512 0.000000e+00 1712.0
9 TraesCS4A01G360400 chr4A 97.567 863 18 3 1061 1922 633604451 633605311 0.000000e+00 1474.0
10 TraesCS4A01G360400 chr4A 90.363 882 75 10 1867 2743 635848438 635847562 0.000000e+00 1149.0
11 TraesCS4A01G360400 chr4A 89.262 922 51 17 1180 2089 635671604 635670719 0.000000e+00 1110.0
12 TraesCS4A01G360400 chr4A 97.885 520 11 0 1 520 633603163 633603682 0.000000e+00 900.0
13 TraesCS4A01G360400 chr4A 97.885 520 11 0 1 520 633648382 633648901 0.000000e+00 900.0
14 TraesCS4A01G360400 chr4A 96.761 494 14 2 517 1009 633603985 633604477 0.000000e+00 822.0
15 TraesCS4A01G360400 chr4A 96.082 485 19 0 1 485 633710299 633710783 0.000000e+00 791.0
16 TraesCS4A01G360400 chr4A 96.603 471 16 0 1 471 633403769 633404239 0.000000e+00 782.0
17 TraesCS4A01G360400 chr4A 97.177 248 7 0 558 805 633404522 633404769 1.810000e-113 420.0
18 TraesCS4A01G360400 chr4A 93.103 58 4 0 554 611 633711084 633711141 7.490000e-13 86.1
19 TraesCS4A01G360400 chr5D 94.555 2002 105 4 2203 4202 536095981 536097980 0.000000e+00 3090.0
20 TraesCS4A01G360400 chr5D 95.038 1955 88 8 2253 4202 536005225 536007175 0.000000e+00 3064.0
21 TraesCS4A01G360400 chr5D 94.710 1380 66 2 764 2141 536003363 536004737 0.000000e+00 2137.0
22 TraesCS4A01G360400 chr5D 89.443 682 43 13 681 1349 536095324 536095989 0.000000e+00 833.0
23 TraesCS4A01G360400 chr5D 89.147 516 50 5 1 512 536002006 536002519 4.580000e-179 638.0
24 TraesCS4A01G360400 chrUn 97.660 1496 26 1 2005 3500 395445862 395447348 0.000000e+00 2560.0
25 TraesCS4A01G360400 chrUn 97.979 1435 18 3 2771 4203 370623804 370625229 0.000000e+00 2479.0
26 TraesCS4A01G360400 chrUn 98.118 850 16 0 1073 1922 410990205 410989356 0.000000e+00 1482.0
27 TraesCS4A01G360400 chrUn 96.154 494 17 2 517 1009 410990683 410990191 0.000000e+00 806.0
28 TraesCS4A01G360400 chrUn 100.000 182 0 0 1 182 480516632 480516451 1.870000e-88 337.0
29 TraesCS4A01G360400 chr5B 91.682 1671 100 13 1 1652 676465619 676467269 0.000000e+00 2279.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G360400 chr4A 633446667 633450869 4202 False 7762.000000 7762 100.000000 1 4203 1 chr4A.!!$F1 4202
1 TraesCS4A01G360400 chr4A 633719724 633723322 3598 False 6211.000000 6211 97.833000 608 4203 1 chr4A.!!$F5 3595
2 TraesCS4A01G360400 chr4A 633513999 633517018 3019 False 5282.000000 5282 98.246000 1185 4203 1 chr4A.!!$F3 3018
3 TraesCS4A01G360400 chr4A 633538701 633541612 2911 False 5029.000000 5029 97.810000 1283 4201 1 chr4A.!!$F4 2918
4 TraesCS4A01G360400 chr4A 633487658 633492318 4660 False 3783.500000 3871 98.594500 1 4203 2 chr4A.!!$F7 4202
5 TraesCS4A01G360400 chr4A 633648382 633652404 4022 False 2361.500000 3823 97.989000 1 4203 2 chr4A.!!$F9 4202
6 TraesCS4A01G360400 chr4A 633403769 633407920 4151 False 2218.666667 5454 97.229000 1 4203 3 chr4A.!!$F6 4202
7 TraesCS4A01G360400 chr4A 633472506 633473512 1006 False 1712.000000 1712 97.324000 1185 2193 1 chr4A.!!$F2 1008
8 TraesCS4A01G360400 chr4A 635847562 635848438 876 True 1149.000000 1149 90.363000 1867 2743 1 chr4A.!!$R2 876
9 TraesCS4A01G360400 chr4A 635670719 635671604 885 True 1110.000000 1110 89.262000 1180 2089 1 chr4A.!!$R1 909
10 TraesCS4A01G360400 chr4A 633603163 633605311 2148 False 1065.333333 1474 97.404333 1 1922 3 chr4A.!!$F8 1921
11 TraesCS4A01G360400 chr4A 633710299 633711141 842 False 438.550000 791 94.592500 1 611 2 chr4A.!!$F10 610
12 TraesCS4A01G360400 chr5D 536095324 536097980 2656 False 1961.500000 3090 91.999000 681 4202 2 chr5D.!!$F2 3521
13 TraesCS4A01G360400 chr5D 536002006 536007175 5169 False 1946.333333 3064 92.965000 1 4202 3 chr5D.!!$F1 4201
14 TraesCS4A01G360400 chrUn 395445862 395447348 1486 False 2560.000000 2560 97.660000 2005 3500 1 chrUn.!!$F2 1495
15 TraesCS4A01G360400 chrUn 370623804 370625229 1425 False 2479.000000 2479 97.979000 2771 4203 1 chrUn.!!$F1 1432
16 TraesCS4A01G360400 chrUn 410989356 410990683 1327 True 1144.000000 1482 97.136000 517 1922 2 chrUn.!!$R2 1405
17 TraesCS4A01G360400 chr5B 676465619 676467269 1650 False 2279.000000 2279 91.682000 1 1652 1 chr5B.!!$F1 1651

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
819 1428 0.982704 AGGCATGCTCACAAGTCTCT 59.017 50.000 18.92 0.0 0.0 3.10 F
1025 1648 2.514592 CGGTTGCCATGCGGATCT 60.515 61.111 0.00 0.0 0.0 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3056 4521 8.696374 TGTTATGCTGAGCTAAGTAGATAAAGT 58.304 33.333 5.83 0.0 0.00 2.66 R
3666 5146 1.002087 ACTTTCCAGCGAACGGAATCT 59.998 47.619 2.02 0.0 42.07 2.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
391 400 1.541233 GCTGGCGAGCAACCATAGTAT 60.541 52.381 16.60 0.00 45.46 2.12
819 1428 0.982704 AGGCATGCTCACAAGTCTCT 59.017 50.000 18.92 0.00 0.00 3.10
1025 1648 2.514592 CGGTTGCCATGCGGATCT 60.515 61.111 0.00 0.00 0.00 2.75
1563 2188 2.914097 GGCAGTGGCAGCAAGGTT 60.914 61.111 12.58 0.00 43.71 3.50
3056 4521 1.153568 CCAAGCTTGGCTCGATCGA 60.154 57.895 31.70 18.32 42.21 3.59
3066 4531 4.485024 TGGCTCGATCGACTTTATCTAC 57.515 45.455 15.15 0.00 0.00 2.59
3666 5146 7.057894 ACCTGTGACCTATTTTGTTGAAACTA 58.942 34.615 0.00 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
384 393 4.964897 TGGCCATCTAGATCCCATACTATG 59.035 45.833 14.76 0.00 0.00 2.23
391 400 1.061424 TCCTTGGCCATCTAGATCCCA 60.061 52.381 6.09 14.76 0.00 4.37
523 844 0.321653 ACCTTCGCTTCACCATCCAC 60.322 55.000 0.00 0.00 0.00 4.02
736 1070 2.061509 TATACTCACTGTGGCGCCTA 57.938 50.000 29.70 15.92 0.00 3.93
819 1428 3.119424 TGAACACGTGTACTGAACTGACA 60.119 43.478 23.69 6.76 0.00 3.58
3056 4521 8.696374 TGTTATGCTGAGCTAAGTAGATAAAGT 58.304 33.333 5.83 0.00 0.00 2.66
3666 5146 1.002087 ACTTTCCAGCGAACGGAATCT 59.998 47.619 2.02 0.00 42.07 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.