Multiple sequence alignment - TraesCS4A01G351200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G351200 chr4A 100.000 3032 0 0 1 3032 627168584 627165553 0.000000e+00 5600
1 TraesCS4A01G351200 chr4A 99.274 3032 22 0 1 3032 627088933 627085902 0.000000e+00 5478
2 TraesCS4A01G351200 chr4A 96.571 2508 73 7 1 2504 627291783 627289285 0.000000e+00 4143
3 TraesCS4A01G351200 chr4A 99.306 2160 14 1 1 2160 627005431 627003273 0.000000e+00 3904
4 TraesCS4A01G351200 chr4A 94.068 2512 116 10 1 2490 627303143 627300643 0.000000e+00 3783
5 TraesCS4A01G351200 chr4A 99.542 873 4 0 2160 3032 627000913 627000041 0.000000e+00 1591
6 TraesCS4A01G351200 chr4A 82.293 1378 179 33 929 2261 626990380 626989023 0.000000e+00 1133
7 TraesCS4A01G351200 chr4A 97.540 569 12 1 2464 3032 627289290 627288724 0.000000e+00 972
8 TraesCS4A01G351200 chr4A 83.832 668 75 16 927 1568 627052559 627051899 3.340000e-169 604
9 TraesCS4A01G351200 chr4A 83.234 668 78 17 927 1568 627255875 627255216 1.570000e-162 582
10 TraesCS4A01G351200 chr5B 89.078 2527 213 30 1 2485 684031052 684033557 0.000000e+00 3079
11 TraesCS4A01G351200 chr5B 88.657 2539 213 33 1 2485 684038053 684040570 0.000000e+00 3024
12 TraesCS4A01G351200 chr5B 84.412 1360 157 28 927 2252 684049584 684050922 0.000000e+00 1286
13 TraesCS4A01G351200 chr5B 91.912 544 38 2 2491 3030 533989649 533989108 0.000000e+00 756
14 TraesCS4A01G351200 chr5B 73.280 1250 257 49 1030 2239 684061072 684062284 1.320000e-103 387
15 TraesCS4A01G351200 chr5D 91.237 2271 148 24 1 2234 541989322 541991578 0.000000e+00 3044
16 TraesCS4A01G351200 chr5D 96.111 540 19 1 2491 3030 360997154 360996617 0.000000e+00 880
17 TraesCS4A01G351200 chr5D 74.663 1188 219 49 989 2128 542308621 542309774 4.610000e-123 451
18 TraesCS4A01G351200 chr5D 89.140 221 14 5 2272 2490 541991579 541991791 1.790000e-67 267
19 TraesCS4A01G351200 chr5D 78.333 300 54 9 1953 2250 542097422 542097712 1.860000e-42 183
20 TraesCS4A01G351200 chr5D 84.091 132 18 2 1953 2084 542316765 542316893 1.140000e-24 124
21 TraesCS4A01G351200 chr7A 96.733 551 15 3 2481 3030 669696949 669696401 0.000000e+00 915
22 TraesCS4A01G351200 chr1D 95.556 540 22 1 2491 3030 50507 51044 0.000000e+00 863
23 TraesCS4A01G351200 chrUn 92.015 526 36 2 2505 3030 70992407 70991888 0.000000e+00 734
24 TraesCS4A01G351200 chr6D 91.412 524 39 5 2512 3030 3454808 3454286 0.000000e+00 713
25 TraesCS4A01G351200 chr3D 80.333 300 50 9 609 903 540275480 540275185 5.090000e-53 219
26 TraesCS4A01G351200 chr3A 80.546 293 44 11 619 903 675350799 675350512 2.370000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G351200 chr4A 627165553 627168584 3031 True 5600.0 5600 100.0000 1 3032 1 chr4A.!!$R4 3031
1 TraesCS4A01G351200 chr4A 627085902 627088933 3031 True 5478.0 5478 99.2740 1 3032 1 chr4A.!!$R3 3031
2 TraesCS4A01G351200 chr4A 627300643 627303143 2500 True 3783.0 3783 94.0680 1 2490 1 chr4A.!!$R6 2489
3 TraesCS4A01G351200 chr4A 627000041 627005431 5390 True 2747.5 3904 99.4240 1 3032 2 chr4A.!!$R7 3031
4 TraesCS4A01G351200 chr4A 627288724 627291783 3059 True 2557.5 4143 97.0555 1 3032 2 chr4A.!!$R8 3031
5 TraesCS4A01G351200 chr4A 626989023 626990380 1357 True 1133.0 1133 82.2930 929 2261 1 chr4A.!!$R1 1332
6 TraesCS4A01G351200 chr4A 627051899 627052559 660 True 604.0 604 83.8320 927 1568 1 chr4A.!!$R2 641
7 TraesCS4A01G351200 chr4A 627255216 627255875 659 True 582.0 582 83.2340 927 1568 1 chr4A.!!$R5 641
8 TraesCS4A01G351200 chr5B 684031052 684033557 2505 False 3079.0 3079 89.0780 1 2485 1 chr5B.!!$F1 2484
9 TraesCS4A01G351200 chr5B 684038053 684040570 2517 False 3024.0 3024 88.6570 1 2485 1 chr5B.!!$F2 2484
10 TraesCS4A01G351200 chr5B 684049584 684050922 1338 False 1286.0 1286 84.4120 927 2252 1 chr5B.!!$F3 1325
11 TraesCS4A01G351200 chr5B 533989108 533989649 541 True 756.0 756 91.9120 2491 3030 1 chr5B.!!$R1 539
12 TraesCS4A01G351200 chr5B 684061072 684062284 1212 False 387.0 387 73.2800 1030 2239 1 chr5B.!!$F4 1209
13 TraesCS4A01G351200 chr5D 541989322 541991791 2469 False 1655.5 3044 90.1885 1 2490 2 chr5D.!!$F4 2489
14 TraesCS4A01G351200 chr5D 360996617 360997154 537 True 880.0 880 96.1110 2491 3030 1 chr5D.!!$R1 539
15 TraesCS4A01G351200 chr5D 542308621 542309774 1153 False 451.0 451 74.6630 989 2128 1 chr5D.!!$F2 1139
16 TraesCS4A01G351200 chr7A 669696401 669696949 548 True 915.0 915 96.7330 2481 3030 1 chr7A.!!$R1 549
17 TraesCS4A01G351200 chr1D 50507 51044 537 False 863.0 863 95.5560 2491 3030 1 chr1D.!!$F1 539
18 TraesCS4A01G351200 chrUn 70991888 70992407 519 True 734.0 734 92.0150 2505 3030 1 chrUn.!!$R1 525
19 TraesCS4A01G351200 chr6D 3454286 3454808 522 True 713.0 713 91.4120 2512 3030 1 chr6D.!!$R1 518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
413 415 4.346709 TGAGTAAAGGATGACACCACTCAA 59.653 41.667 0.0 0.0 37.46 3.02 F
734 751 4.526262 CCTTCTCTCTTTCTCTCTCAACCA 59.474 45.833 0.0 0.0 0.00 3.67 F
1479 1557 2.267351 CGACTGCCATTTGTGCCCA 61.267 57.895 0.0 0.0 0.00 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1479 1557 0.599204 ACACGAACGCCACGAGAAAT 60.599 50.000 0.00 0.0 34.70 2.17 R
1887 1980 1.361668 CCATACACGCTGACACTGCC 61.362 60.000 0.00 0.0 0.00 4.85 R
2287 4796 5.535333 TGACTAGTTAGTAACTTGGTGCAC 58.465 41.667 20.28 8.8 42.81 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
394 396 5.045286 AGAGGATTAATGAAGGTTGCTGAGT 60.045 40.000 0.00 0.0 0.00 3.41
413 415 4.346709 TGAGTAAAGGATGACACCACTCAA 59.653 41.667 0.00 0.0 37.46 3.02
734 751 4.526262 CCTTCTCTCTTTCTCTCTCAACCA 59.474 45.833 0.00 0.0 0.00 3.67
1479 1557 2.267351 CGACTGCCATTTGTGCCCA 61.267 57.895 0.00 0.0 0.00 5.36
2287 4796 1.560923 CGGCTCGTTCTAGTTGGATG 58.439 55.000 0.00 0.0 0.00 3.51
2696 5252 3.541632 CCTGCCTATAAACACGAACCAT 58.458 45.455 0.00 0.0 0.00 3.55
2915 5476 2.490148 CCCCAGCTCATCGACGCTA 61.490 63.158 5.51 0.0 34.58 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
349 351 6.553100 CCTCTCTCAACATAGGTAGGAAGATT 59.447 42.308 0.00 0.0 0.00 2.40
394 396 5.939883 CAGATTTGAGTGGTGTCATCCTTTA 59.060 40.000 0.00 0.0 0.00 1.85
413 415 4.202461 TGACTCTAAAGTTGGTGGCAGATT 60.202 41.667 0.00 0.0 35.28 2.40
734 751 3.249189 ACCACCGTGCCTGGATGT 61.249 61.111 0.00 0.0 32.55 3.06
1479 1557 0.599204 ACACGAACGCCACGAGAAAT 60.599 50.000 0.00 0.0 34.70 2.17
1887 1980 1.361668 CCATACACGCTGACACTGCC 61.362 60.000 0.00 0.0 0.00 4.85
2287 4796 5.535333 TGACTAGTTAGTAACTTGGTGCAC 58.465 41.667 20.28 8.8 42.81 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.