Multiple sequence alignment - TraesCS4A01G343200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G343200 chr4A 100.000 3211 0 0 1 3211 622520645 622517435 0.000000e+00 5930.0
1 TraesCS4A01G343200 chr4A 98.661 3212 22 3 1 3211 622452137 622448946 0.000000e+00 5674.0
2 TraesCS4A01G343200 chr4A 99.279 2495 17 1 1 2494 622486253 622483759 0.000000e+00 4506.0
3 TraesCS4A01G343200 chr4A 98.856 699 8 0 2513 3211 622483703 622483005 0.000000e+00 1247.0
4 TraesCS4A01G343200 chr4A 86.545 877 70 24 1000 1847 622185174 622186031 0.000000e+00 922.0
5 TraesCS4A01G343200 chr4A 84.058 759 71 18 1115 1845 622444544 622443808 0.000000e+00 686.0
6 TraesCS4A01G343200 chr4A 95.307 277 10 3 228 502 511884606 511884331 1.370000e-118 436.0
7 TraesCS4A01G343200 chr4A 89.474 152 13 1 77 228 572640198 572640050 4.230000e-44 189.0
8 TraesCS4A01G343200 chr4A 72.043 279 59 13 2708 2984 696020067 696019806 7.440000e-07 65.8
9 TraesCS4A01G343200 chr4A 100.000 28 0 0 699 726 736819663 736819690 6.000000e-03 52.8
10 TraesCS4A01G343200 chr5D 86.716 1227 93 27 807 2004 546472885 546474070 0.000000e+00 1299.0
11 TraesCS4A01G343200 chr5D 86.546 996 87 22 1000 1985 546454852 546455810 0.000000e+00 1053.0
12 TraesCS4A01G343200 chr5D 87.331 592 65 6 1018 1607 546460825 546461408 0.000000e+00 669.0
13 TraesCS4A01G343200 chr5D 83.471 121 9 5 843 958 546358210 546358324 5.670000e-18 102.0
14 TraesCS4A01G343200 chr5B 88.889 1062 78 16 806 1841 689653116 689654163 0.000000e+00 1271.0
15 TraesCS4A01G343200 chr5B 86.791 1128 98 20 906 2004 689658692 689659797 0.000000e+00 1210.0
16 TraesCS4A01G343200 chr5B 87.879 1056 79 23 810 1835 689600788 689601824 0.000000e+00 1195.0
17 TraesCS4A01G343200 chr5B 87.218 1064 86 22 806 1845 689632492 689633529 0.000000e+00 1166.0
18 TraesCS4A01G343200 chr5B 86.836 866 72 17 1004 1854 689666379 689667217 0.000000e+00 929.0
19 TraesCS4A01G343200 chr5B 88.480 625 60 7 2512 3126 689660421 689661043 0.000000e+00 745.0
20 TraesCS4A01G343200 chr5B 87.890 545 39 10 1004 1539 689913691 689914217 1.640000e-172 616.0
21 TraesCS4A01G343200 chr5B 87.037 432 47 7 1421 1847 689914258 689914685 2.240000e-131 479.0
22 TraesCS4A01G343200 chr5B 88.473 347 26 9 2087 2431 689659799 689660133 1.070000e-109 407.0
23 TraesCS4A01G343200 chr5B 97.619 84 2 0 3128 3211 16107281 16107364 9.280000e-31 145.0
24 TraesCS4A01G343200 chr5B 83.871 155 22 1 521 672 689458413 689458567 9.280000e-31 145.0
25 TraesCS4A01G343200 chr5B 89.888 89 8 1 1916 2004 689654157 689654244 2.620000e-21 113.0
26 TraesCS4A01G343200 chr5B 91.304 69 4 2 2005 2071 642230868 642230936 3.410000e-15 93.5
27 TraesCS4A01G343200 chr5B 85.366 82 7 5 904 980 689596440 689596521 2.660000e-11 80.5
28 TraesCS4A01G343200 chr3A 96.679 271 8 1 235 504 312039475 312039205 1.760000e-122 449.0
29 TraesCS4A01G343200 chr3A 95.941 271 10 1 235 504 333491720 333491450 3.800000e-119 438.0
30 TraesCS4A01G343200 chr3A 94.982 279 12 2 226 502 108372823 108372545 1.370000e-118 436.0
31 TraesCS4A01G343200 chr3A 90.541 148 9 3 77 224 69643090 69642948 1.180000e-44 191.0
32 TraesCS4A01G343200 chr3A 90.566 53 5 0 3128 3180 112379190 112379242 1.600000e-08 71.3
33 TraesCS4A01G343200 chr1A 96.029 277 9 2 228 502 398249691 398249967 1.760000e-122 449.0
34 TraesCS4A01G343200 chr1A 86.228 167 18 5 62 225 5131725 5131561 3.290000e-40 176.0
35 TraesCS4A01G343200 chr6A 94.464 289 13 3 226 512 562065419 562065706 2.940000e-120 442.0
36 TraesCS4A01G343200 chr6A 90.541 148 13 1 77 224 85700383 85700237 9.090000e-46 195.0
37 TraesCS4A01G343200 chr6B 95.307 277 10 3 231 505 499154194 499153919 1.370000e-118 436.0
38 TraesCS4A01G343200 chr6B 94.000 50 3 0 3128 3177 643573524 643573475 3.430000e-10 76.8
39 TraesCS4A01G343200 chr6D 91.946 149 11 1 77 225 468870242 468870389 1.170000e-49 207.0
40 TraesCS4A01G343200 chr4D 92.466 146 10 1 77 222 481856471 481856615 1.170000e-49 207.0
41 TraesCS4A01G343200 chr7D 90.196 153 9 4 75 225 13796454 13796602 9.090000e-46 195.0
42 TraesCS4A01G343200 chr7D 89.744 78 7 1 3131 3208 276516112 276516036 7.330000e-17 99.0
43 TraesCS4A01G343200 chr7D 88.889 72 6 2 2004 2073 627215537 627215466 1.590000e-13 87.9
44 TraesCS4A01G343200 chr7D 83.750 80 7 5 2005 2078 56649441 56649520 1.600000e-08 71.3
45 TraesCS4A01G343200 chr5A 91.139 79 4 2 2010 2087 180368260 180368336 1.580000e-18 104.0
46 TraesCS4A01G343200 chr2B 88.235 85 8 2 2005 2087 749303482 749303566 2.040000e-17 100.0
47 TraesCS4A01G343200 chr1D 100.000 38 0 0 3128 3165 319684976 319685013 1.600000e-08 71.3
48 TraesCS4A01G343200 chr4B 90.000 50 5 0 2041 2090 636680457 636680408 7.440000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G343200 chr4A 622517435 622520645 3210 True 5930.000000 5930 100.000000 1 3211 1 chr4A.!!$R5 3210
1 TraesCS4A01G343200 chr4A 622448946 622452137 3191 True 5674.000000 5674 98.661000 1 3211 1 chr4A.!!$R4 3210
2 TraesCS4A01G343200 chr4A 622483005 622486253 3248 True 2876.500000 4506 99.067500 1 3211 2 chr4A.!!$R7 3210
3 TraesCS4A01G343200 chr4A 622185174 622186031 857 False 922.000000 922 86.545000 1000 1847 1 chr4A.!!$F1 847
4 TraesCS4A01G343200 chr4A 622443808 622444544 736 True 686.000000 686 84.058000 1115 1845 1 chr4A.!!$R3 730
5 TraesCS4A01G343200 chr5D 546472885 546474070 1185 False 1299.000000 1299 86.716000 807 2004 1 chr5D.!!$F4 1197
6 TraesCS4A01G343200 chr5D 546454852 546455810 958 False 1053.000000 1053 86.546000 1000 1985 1 chr5D.!!$F2 985
7 TraesCS4A01G343200 chr5D 546460825 546461408 583 False 669.000000 669 87.331000 1018 1607 1 chr5D.!!$F3 589
8 TraesCS4A01G343200 chr5B 689600788 689601824 1036 False 1195.000000 1195 87.879000 810 1835 1 chr5B.!!$F5 1025
9 TraesCS4A01G343200 chr5B 689632492 689633529 1037 False 1166.000000 1166 87.218000 806 1845 1 chr5B.!!$F6 1039
10 TraesCS4A01G343200 chr5B 689666379 689667217 838 False 929.000000 929 86.836000 1004 1854 1 chr5B.!!$F7 850
11 TraesCS4A01G343200 chr5B 689658692 689661043 2351 False 787.333333 1210 87.914667 906 3126 3 chr5B.!!$F9 2220
12 TraesCS4A01G343200 chr5B 689653116 689654244 1128 False 692.000000 1271 89.388500 806 2004 2 chr5B.!!$F8 1198
13 TraesCS4A01G343200 chr5B 689913691 689914685 994 False 547.500000 616 87.463500 1004 1847 2 chr5B.!!$F10 843

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
46 47 1.800586 GAAGCTTCGTCAGTGAATGCA 59.199 47.619 11.4 0.0 0.0 3.96 F
1309 1367 1.160137 CAAGAAGGACAAGAAGCCCG 58.840 55.000 0.0 0.0 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1708 1973 1.153765 GAAAGAAGGGCGGCATTGC 60.154 57.895 15.43 5.65 0.00 3.56 R
3047 3576 4.906792 CTAGCTGGGAGCAGGCGC 62.907 72.222 0.00 0.00 45.56 6.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 1.800586 GAAGCTTCGTCAGTGAATGCA 59.199 47.619 11.40 0.00 0.00 3.96
233 234 5.981315 GGTCAGCGTGTAATTGTATAAGCTA 59.019 40.000 0.00 0.00 34.75 3.32
761 762 4.268797 TGTAAATTAGTGTGGGCGTACA 57.731 40.909 0.00 0.00 0.00 2.90
1016 1024 7.946207 AGCTGTAATCTATATATAGCACGCAT 58.054 34.615 14.03 0.77 39.23 4.73
1188 1228 1.219393 GCTTCTCCCGGGTCTTCTG 59.781 63.158 22.86 8.41 0.00 3.02
1309 1367 1.160137 CAAGAAGGACAAGAAGCCCG 58.840 55.000 0.00 0.00 0.00 6.13
1707 1972 3.047807 GCCTGACCCCAGCATGCTA 62.048 63.158 22.19 2.09 39.07 3.49
1708 1973 1.147824 CCTGACCCCAGCATGCTAG 59.852 63.158 22.19 13.89 39.07 3.42
2498 2980 3.621558 CAAAATTGGTCTCCCCTAGGAC 58.378 50.000 11.48 0.00 37.19 3.85
2854 3381 4.982295 GGCTTGTTTTTCAATAGAAAGCGT 59.018 37.500 0.00 0.00 44.03 5.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
233 234 8.974292 ACTATATGATACTCCCCATTACAACT 57.026 34.615 0.00 0.00 0.00 3.16
697 698 8.267620 TGTGAGTGATTTCAATTGTACTATGG 57.732 34.615 5.13 0.00 0.00 2.74
761 762 6.971527 TTTCGGTATTGAATTGACACGTAT 57.028 33.333 0.00 0.00 0.00 3.06
1016 1024 2.424842 GATGGAGTTGGGTGGGTGCA 62.425 60.000 0.00 0.00 0.00 4.57
1707 1972 1.598701 GAAAGAAGGGCGGCATTGCT 61.599 55.000 15.43 8.04 34.52 3.91
1708 1973 1.153765 GAAAGAAGGGCGGCATTGC 60.154 57.895 15.43 5.65 0.00 3.56
2319 2626 7.408132 TTTAACTTTGTTCACTCTCTCATCG 57.592 36.000 0.00 0.00 0.00 3.84
3047 3576 4.906792 CTAGCTGGGAGCAGGCGC 62.907 72.222 0.00 0.00 45.56 6.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.