Multiple sequence alignment - TraesCS4A01G342000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G342000 chr4A 100.000 2404 0 0 1 2404 622161368 622163771 0.000000e+00 4440.0
1 TraesCS4A01G342000 chr4A 87.963 324 31 4 1980 2298 716535122 716534802 2.260000e-100 375.0
2 TraesCS4A01G342000 chr4A 100.000 30 0 0 2372 2401 726216880 726216909 3.340000e-04 56.5
3 TraesCS4A01G342000 chr1A 96.804 2409 66 7 1 2404 143378965 143376563 0.000000e+00 4012.0
4 TraesCS4A01G342000 chr1A 95.046 1837 82 5 1 1832 480976004 480974172 0.000000e+00 2880.0
5 TraesCS4A01G342000 chr2B 96.719 2408 69 5 1 2404 631837 634238 0.000000e+00 4000.0
6 TraesCS4A01G342000 chr2B 93.281 2411 132 11 1 2404 488701813 488704200 0.000000e+00 3528.0
7 TraesCS4A01G342000 chr7A 94.235 2411 126 9 1 2404 346769593 346767189 0.000000e+00 3670.0
8 TraesCS4A01G342000 chr3D 96.356 1674 60 1 731 2404 124495014 124493342 0.000000e+00 2752.0
9 TraesCS4A01G342000 chr3D 95.664 738 24 4 1 732 124495797 124495062 0.000000e+00 1179.0
10 TraesCS4A01G342000 chr7B 96.604 589 14 2 1 585 511463903 511463317 0.000000e+00 972.0
11 TraesCS4A01G342000 chr1B 90.451 377 29 4 50 422 200035722 200035349 7.720000e-135 490.0
12 TraesCS4A01G342000 chr6A 85.078 449 51 7 50 493 239316431 239316868 6.100000e-121 444.0
13 TraesCS4A01G342000 chr5A 87.725 334 32 3 1837 2165 219128348 219128677 4.850000e-102 381.0
14 TraesCS4A01G342000 chr5A 87.725 334 30 4 1837 2165 208947309 208947636 1.740000e-101 379.0
15 TraesCS4A01G342000 chr5A 93.878 49 3 0 2356 2404 208947633 208947681 9.220000e-10 75.0
16 TraesCS4A01G342000 chr5A 95.455 44 2 0 2356 2399 219128674 219128717 1.190000e-08 71.3
17 TraesCS4A01G342000 chr5A 94.444 36 1 1 1482 1517 704455081 704455047 1.000000e-03 54.7
18 TraesCS4A01G342000 chrUn 88.583 254 23 2 1912 2159 402215522 402215775 1.080000e-78 303.0
19 TraesCS4A01G342000 chrUn 89.189 74 4 1 1837 1910 333864591 333864660 3.290000e-14 89.8
20 TraesCS4A01G342000 chrUn 89.189 74 4 1 1837 1910 388630247 388630316 3.290000e-14 89.8
21 TraesCS4A01G342000 chrUn 93.878 49 3 0 2356 2404 402215831 402215879 9.220000e-10 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G342000 chr4A 622161368 622163771 2403 False 4440.0 4440 100.000 1 2404 1 chr4A.!!$F1 2403
1 TraesCS4A01G342000 chr1A 143376563 143378965 2402 True 4012.0 4012 96.804 1 2404 1 chr1A.!!$R1 2403
2 TraesCS4A01G342000 chr1A 480974172 480976004 1832 True 2880.0 2880 95.046 1 1832 1 chr1A.!!$R2 1831
3 TraesCS4A01G342000 chr2B 631837 634238 2401 False 4000.0 4000 96.719 1 2404 1 chr2B.!!$F1 2403
4 TraesCS4A01G342000 chr2B 488701813 488704200 2387 False 3528.0 3528 93.281 1 2404 1 chr2B.!!$F2 2403
5 TraesCS4A01G342000 chr7A 346767189 346769593 2404 True 3670.0 3670 94.235 1 2404 1 chr7A.!!$R1 2403
6 TraesCS4A01G342000 chr3D 124493342 124495797 2455 True 1965.5 2752 96.010 1 2404 2 chr3D.!!$R1 2403
7 TraesCS4A01G342000 chr7B 511463317 511463903 586 True 972.0 972 96.604 1 585 1 chr7B.!!$R1 584

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
417 427 0.90961 CAGAGGCTTGTGGTAGGGGA 60.91 60.0 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 2175 0.036732 TGATCCAAGGCCACACAGAC 59.963 55.0 5.01 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 1.880340 GATTCGGTCTGGAGCAGCG 60.880 63.158 0.84 0.00 0.00 5.18
27 28 4.742201 TTCGGTCTGGAGCAGCGC 62.742 66.667 0.00 0.00 0.00 5.92
269 279 4.034048 CGTGCTATGTTCAGAATTGGTACC 59.966 45.833 4.43 4.43 0.00 3.34
417 427 0.909610 CAGAGGCTTGTGGTAGGGGA 60.910 60.000 0.00 0.00 0.00 4.81
625 637 4.081142 TGCTACAACAATAGCTTGCCTCTA 60.081 41.667 0.00 0.00 46.54 2.43
829 891 8.656849 CACTTAGTCTGCATAAAATTCGTTAGT 58.343 33.333 0.00 0.00 0.00 2.24
933 1009 5.156804 AGTTTGATATTTTTCTAGGCGCG 57.843 39.130 0.00 0.00 0.00 6.86
987 1063 1.447643 CCCGAGTCACCATCATCCC 59.552 63.158 0.00 0.00 0.00 3.85
1289 1367 3.738982 TCTTGTGGCGAATTCTTGAAGA 58.261 40.909 3.52 0.00 0.00 2.87
1535 1613 0.391927 GCGTTAGGTGTGCATGGGTA 60.392 55.000 0.00 0.00 0.00 3.69
1603 1682 5.359194 TTTTCTTCCTCTATTCCATCGCT 57.641 39.130 0.00 0.00 0.00 4.93
1620 1699 4.019513 TCCTCACGGGTCCCCCAT 62.020 66.667 1.00 0.00 45.83 4.00
1698 1778 0.613260 TTGTAGCTCAATCCACGCCT 59.387 50.000 0.00 0.00 0.00 5.52
1746 1826 1.667830 CGAAAACGCTGCCTCCTCA 60.668 57.895 0.00 0.00 0.00 3.86
1749 1829 3.883744 AAACGCTGCCTCCTCACCG 62.884 63.158 0.00 0.00 0.00 4.94
2092 2172 0.391661 GCAGCAGTGAATCTCGGGAA 60.392 55.000 0.00 0.00 0.00 3.97
2095 2175 1.065854 AGCAGTGAATCTCGGGAAAGG 60.066 52.381 0.00 0.00 0.00 3.11
2181 2262 7.341769 TGACCCAATAAAATATTTGTAGCTGCT 59.658 33.333 7.57 7.57 0.00 4.24
2219 2300 3.283751 TGTTTGTTTCACGGATCCAAGT 58.716 40.909 13.41 0.00 0.00 3.16
2279 2360 5.278169 CCACATATGGTCTCTGCTTAATTGC 60.278 44.000 7.80 0.00 41.64 3.56
2308 2389 2.605030 CAGTAGTGCAGCTGAGTTCTC 58.395 52.381 20.43 0.00 34.87 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 151 8.193438 GTCGTAATCCCAGTAGTATTTACTTGT 58.807 37.037 0.00 0.00 37.73 3.16
417 427 3.706086 AGTTTCCAACTGGCAGTGATTTT 59.294 39.130 22.83 1.09 41.01 1.82
625 637 0.698818 GTTCCTGACCCCTGAACCAT 59.301 55.000 0.00 0.00 33.85 3.55
1137 1213 1.147153 AGGATAAGCGGCCTTCAGC 59.853 57.895 0.00 0.00 42.60 4.26
1358 1436 8.795513 TGACATAAAGAAAAGCATGATCTTTGA 58.204 29.630 18.51 9.07 41.93 2.69
1452 1530 3.498774 AGAGCAGACATGTCCAGTTTT 57.501 42.857 22.21 6.14 0.00 2.43
1453 1531 4.833478 ATAGAGCAGACATGTCCAGTTT 57.167 40.909 22.21 8.41 0.00 2.66
1620 1699 3.319198 GGAGGGAGCGTGTGGGAA 61.319 66.667 0.00 0.00 0.00 3.97
2092 2172 1.151450 CCAAGGCCACACAGACCTT 59.849 57.895 5.01 0.00 44.66 3.50
2095 2175 0.036732 TGATCCAAGGCCACACAGAC 59.963 55.000 5.01 0.00 0.00 3.51
2181 2262 7.846644 AACAAACAATTCATCTCAGCAAAAA 57.153 28.000 0.00 0.00 0.00 1.94
2219 2300 1.476891 TGGTTTAGCGCCAAAACAACA 59.523 42.857 27.34 18.38 38.34 3.33
2308 2389 1.032114 GCAAGGAGGGTGGGATTTCG 61.032 60.000 0.00 0.00 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.