Multiple sequence alignment - TraesCS4A01G337500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G337500 chr4A 100.000 2629 0 0 1 2629 619592567 619589939 0 4855
1 TraesCS4A01G337500 chr4A 98.175 2630 46 2 1 2629 619461569 619458941 0 4590
2 TraesCS4A01G337500 chr4A 98.023 2630 51 1 1 2629 619531088 619528459 0 4567
3 TraesCS4A01G337500 chr6B 96.617 2631 80 6 4 2629 631444539 631441913 0 4357
4 TraesCS4A01G337500 chr2B 96.467 2632 86 4 3 2629 785342762 785345391 0 4338
5 TraesCS4A01G337500 chr7B 96.090 2634 95 5 1 2629 80484453 80487083 0 4287
6 TraesCS4A01G337500 chr7B 95.977 2635 97 6 1 2629 712649846 712647215 0 4270
7 TraesCS4A01G337500 chr1B 96.123 2631 90 9 5 2629 567437669 567440293 0 4283


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G337500 chr4A 619589939 619592567 2628 True 4855 4855 100.000 1 2629 1 chr4A.!!$R3 2628
1 TraesCS4A01G337500 chr4A 619458941 619461569 2628 True 4590 4590 98.175 1 2629 1 chr4A.!!$R1 2628
2 TraesCS4A01G337500 chr4A 619528459 619531088 2629 True 4567 4567 98.023 1 2629 1 chr4A.!!$R2 2628
3 TraesCS4A01G337500 chr6B 631441913 631444539 2626 True 4357 4357 96.617 4 2629 1 chr6B.!!$R1 2625
4 TraesCS4A01G337500 chr2B 785342762 785345391 2629 False 4338 4338 96.467 3 2629 1 chr2B.!!$F1 2626
5 TraesCS4A01G337500 chr7B 80484453 80487083 2630 False 4287 4287 96.090 1 2629 1 chr7B.!!$F1 2628
6 TraesCS4A01G337500 chr7B 712647215 712649846 2631 True 4270 4270 95.977 1 2629 1 chr7B.!!$R1 2628
7 TraesCS4A01G337500 chr1B 567437669 567440293 2624 False 4283 4283 96.123 5 2629 1 chr1B.!!$F1 2624

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
804 809 3.057033 GCACATTCATGGAACTCAGCTTT 60.057 43.478 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1881 1886 2.358247 CGGTTTGGCCAGCGTACT 60.358 61.111 5.11 0.0 36.97 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 4.082733 GGTCCAGTTCTTTTGGCTGTATTC 60.083 45.833 0.00 0.00 35.62 1.75
168 169 5.570320 GTGGATATATGCCCTGGTTGTTAT 58.430 41.667 1.35 0.00 0.00 1.89
433 435 9.462174 TTCATGTAACTCAGCATGTTTTTAAAG 57.538 29.630 0.00 0.00 42.09 1.85
535 538 5.818336 GGCTAAATCTTAGGTTCTGGTCTTC 59.182 44.000 0.00 0.00 0.00 2.87
680 685 5.491078 AGGAGACCATGGTTGGATAGTTTTA 59.509 40.000 20.85 0.00 46.92 1.52
804 809 3.057033 GCACATTCATGGAACTCAGCTTT 60.057 43.478 0.00 0.00 0.00 3.51
1344 1349 5.253330 CCATTTGTCTTGTACACCATAGGT 58.747 41.667 0.00 0.00 38.00 3.08
1436 1441 4.331968 ACGATAAAGGGCACAAATCTTGA 58.668 39.130 0.00 0.00 0.00 3.02
1876 1881 0.112995 AGGCCTTTCATTCCAGCACA 59.887 50.000 0.00 0.00 0.00 4.57
1881 1886 3.696051 GCCTTTCATTCCAGCACAAGATA 59.304 43.478 0.00 0.00 0.00 1.98
1907 1912 1.228154 GGCCAAACCGAAGACTGGT 60.228 57.895 0.00 0.00 42.98 4.00
2305 2310 0.860533 TAAAGACAAAACGCGACGGG 59.139 50.000 15.93 10.72 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 7.625828 AAAGATATAGTTCCCGTTTCTTTGG 57.374 36.000 0.00 0.00 32.41 3.28
193 194 7.891183 AGGACGAACTATGATCTATGAGGTTAT 59.109 37.037 0.00 0.00 0.00 1.89
194 195 7.232188 AGGACGAACTATGATCTATGAGGTTA 58.768 38.462 0.00 0.00 0.00 2.85
449 452 0.249911 CTAGCGCCCTCCCATAACAC 60.250 60.000 2.29 0.00 0.00 3.32
804 809 9.349713 ACTTCATGAGGTAATTTGTTTACAAGA 57.650 29.630 9.00 0.00 41.74 3.02
1344 1349 7.771361 TCCTCTTTTGTTCGGCATACATATTTA 59.229 33.333 0.00 0.00 0.00 1.40
1626 1631 4.623932 ATTGGTGCACTCTGAACTTCTA 57.376 40.909 17.98 0.00 0.00 2.10
1876 1881 2.629051 GTTTGGCCAGCGTACTATCTT 58.371 47.619 5.11 0.00 0.00 2.40
1881 1886 2.358247 CGGTTTGGCCAGCGTACT 60.358 61.111 5.11 0.00 36.97 2.73
1907 1912 4.021807 TGATGTAACTCGTTTACCTGAGCA 60.022 41.667 7.07 0.00 39.64 4.26
2545 2555 8.525316 TGCAAGATCACATGTTATTTCTGAAAT 58.475 29.630 18.64 18.64 34.90 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.