Multiple sequence alignment - TraesCS4A01G337400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G337400 chr4A 100.000 2942 0 0 1 2942 619584677 619581736 0.000000e+00 5433.0
1 TraesCS4A01G337400 chr4A 99.592 2943 11 1 1 2942 619452057 619449115 0.000000e+00 5367.0
2 TraesCS4A01G337400 chr4A 93.825 2348 108 21 552 2873 619744596 619742260 0.000000e+00 3498.0
3 TraesCS4A01G337400 chr4A 99.263 1628 11 1 1 1627 619521570 619519943 0.000000e+00 2939.0
4 TraesCS4A01G337400 chr4A 99.545 1319 4 2 1625 2942 619511702 619510385 0.000000e+00 2401.0
5 TraesCS4A01G337400 chr4A 86.488 2124 211 32 453 2538 619950279 619948194 0.000000e+00 2263.0
6 TraesCS4A01G337400 chr4A 84.393 1935 199 47 443 2323 619752932 619751047 0.000000e+00 1805.0
7 TraesCS4A01G337400 chr4A 85.580 1699 171 35 671 2323 619997886 619996216 0.000000e+00 1712.0
8 TraesCS4A01G337400 chr4A 92.308 429 32 1 1 428 619767551 619767123 2.510000e-170 608.0
9 TraesCS4A01G337400 chr4A 91.364 440 34 4 505 941 619951416 619950978 1.510000e-167 599.0
10 TraesCS4A01G337400 chr4A 90.909 429 38 1 1 428 620000096 619999668 2.540000e-160 575.0
11 TraesCS4A01G337400 chr4A 92.049 327 25 1 1 326 619957767 619957441 2.670000e-125 459.0
12 TraesCS4A01G337400 chr4A 98.515 202 3 0 1 202 619643660 619643459 1.000000e-94 357.0
13 TraesCS4A01G337400 chr4A 94.286 105 4 2 326 430 619951522 619951420 3.030000e-35 159.0
14 TraesCS4A01G337400 chr5D 87.782 2038 192 29 538 2538 548639641 548637624 0.000000e+00 2331.0
15 TraesCS4A01G337400 chr5D 85.960 1802 171 37 442 2184 548674132 548672354 0.000000e+00 1851.0
16 TraesCS4A01G337400 chr5D 86.374 1732 191 20 222 1944 548679947 548678252 0.000000e+00 1849.0
17 TraesCS4A01G337400 chr5D 76.286 797 88 48 2175 2923 548671159 548670416 6.080000e-87 331.0
18 TraesCS4A01G337400 chr5D 87.591 137 12 3 2626 2757 548637602 548637466 1.410000e-33 154.0
19 TraesCS4A01G337400 chr5B 87.060 2102 214 29 481 2538 692800224 692798137 0.000000e+00 2322.0
20 TraesCS4A01G337400 chr5B 92.557 618 43 3 333 948 692806948 692806332 0.000000e+00 883.0
21 TraesCS4A01G337400 chr5B 89.908 327 32 1 1 326 692845742 692845416 1.260000e-113 420.0
22 TraesCS4A01G337400 chr5B 93.407 91 5 1 2842 2931 692797999 692797909 1.840000e-27 134.0
23 TraesCS4A01G337400 chr5B 86.400 125 11 5 2636 2757 692798113 692797992 6.620000e-27 132.0
24 TraesCS4A01G337400 chrUn 100.000 855 0 0 1625 2479 407037928 407038782 0.000000e+00 1580.0
25 TraesCS4A01G337400 chrUn 100.000 174 0 0 2769 2942 380636755 380636928 3.660000e-84 322.0
26 TraesCS4A01G337400 chr7D 81.526 249 41 5 85 329 37872616 37872369 1.790000e-47 200.0
27 TraesCS4A01G337400 chr7D 97.059 34 1 0 12 45 168241425 168241458 1.140000e-04 58.4
28 TraesCS4A01G337400 chr6A 81.224 245 44 2 85 327 613630771 613631015 2.310000e-46 196.0
29 TraesCS4A01G337400 chr3D 100.000 28 0 0 333 360 373604009 373604036 5.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G337400 chr4A 619581736 619584677 2941 True 5433.000000 5433 100.000000 1 2942 1 chr4A.!!$R4 2941
1 TraesCS4A01G337400 chr4A 619449115 619452057 2942 True 5367.000000 5367 99.592000 1 2942 1 chr4A.!!$R1 2941
2 TraesCS4A01G337400 chr4A 619742260 619744596 2336 True 3498.000000 3498 93.825000 552 2873 1 chr4A.!!$R6 2321
3 TraesCS4A01G337400 chr4A 619519943 619521570 1627 True 2939.000000 2939 99.263000 1 1627 1 chr4A.!!$R3 1626
4 TraesCS4A01G337400 chr4A 619510385 619511702 1317 True 2401.000000 2401 99.545000 1625 2942 1 chr4A.!!$R2 1317
5 TraesCS4A01G337400 chr4A 619751047 619752932 1885 True 1805.000000 1805 84.393000 443 2323 1 chr4A.!!$R7 1880
6 TraesCS4A01G337400 chr4A 619996216 620000096 3880 True 1143.500000 1712 88.244500 1 2323 2 chr4A.!!$R11 2322
7 TraesCS4A01G337400 chr4A 619948194 619951522 3328 True 1007.000000 2263 90.712667 326 2538 3 chr4A.!!$R10 2212
8 TraesCS4A01G337400 chr5D 548678252 548679947 1695 True 1849.000000 1849 86.374000 222 1944 1 chr5D.!!$R1 1722
9 TraesCS4A01G337400 chr5D 548637466 548639641 2175 True 1242.500000 2331 87.686500 538 2757 2 chr5D.!!$R2 2219
10 TraesCS4A01G337400 chr5D 548670416 548674132 3716 True 1091.000000 1851 81.123000 442 2923 2 chr5D.!!$R3 2481
11 TraesCS4A01G337400 chr5B 692806332 692806948 616 True 883.000000 883 92.557000 333 948 1 chr5B.!!$R1 615
12 TraesCS4A01G337400 chr5B 692797909 692800224 2315 True 862.666667 2322 88.955667 481 2931 3 chr5B.!!$R3 2450
13 TraesCS4A01G337400 chrUn 407037928 407038782 854 False 1580.000000 1580 100.000000 1625 2479 1 chrUn.!!$F2 854

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
140 141 1.199558 GTCTTAGCACGACGACTTCCT 59.8 52.381 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2479 6604 4.577246 GGTCGCTCGCCTGGCTAG 62.577 72.222 17.92 16.57 0.0 3.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
117 118 3.245839 TGTTCTGGTGTCCTGGTCCTATA 60.246 47.826 0.0 0.0 0.00 1.31
140 141 1.199558 GTCTTAGCACGACGACTTCCT 59.800 52.381 0.0 0.0 0.00 3.36
300 305 6.113411 CCCTTTATACTACCTTGACAGTTGG 58.887 44.000 0.0 0.0 0.00 3.77
2479 6604 6.699575 AATAGTTGGGCTATCACACAAATC 57.300 37.500 0.0 0.0 39.36 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
117 118 1.245732 AGTCGTCGTGCTAAGACCTT 58.754 50.000 0.00 0.00 35.33 3.50
932 3744 1.349627 GCGAACTGCACATCATCGG 59.650 57.895 0.00 0.00 45.45 4.18
2479 6604 4.577246 GGTCGCTCGCCTGGCTAG 62.577 72.222 17.92 16.57 0.00 3.42
2693 6879 4.869297 TGAACATTTGCCAAAGTTTGAGTG 59.131 37.500 17.33 6.92 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.