Multiple sequence alignment - TraesCS4A01G331800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G331800 chr4A 100.000 2414 0 0 1 2414 616307168 616304755 0.000000e+00 4458
1 TraesCS4A01G331800 chr2A 98.713 2408 28 3 7 2414 597215995 597218399 0.000000e+00 4272
2 TraesCS4A01G331800 chr6A 98.130 2407 36 2 16 2414 18029828 18032233 0.000000e+00 4187
3 TraesCS4A01G331800 chr3A 98.244 2221 36 3 11 2230 913410 911192 0.000000e+00 3882
4 TraesCS4A01G331800 chr3D 94.449 2414 76 15 10 2414 598248525 598250889 0.000000e+00 3663
5 TraesCS4A01G331800 chr3D 92.166 2336 104 26 91 2414 181205586 181203318 0.000000e+00 3227
6 TraesCS4A01G331800 chr4B 93.476 2422 104 23 8 2414 633799119 633801501 0.000000e+00 3548
7 TraesCS4A01G331800 chr1B 92.954 2427 110 21 9 2414 517558072 517555686 0.000000e+00 3478
8 TraesCS4A01G331800 chr6B 93.380 2160 96 16 8 2142 633372913 633375050 0.000000e+00 3153
9 TraesCS4A01G331800 chr6B 91.677 1622 120 10 798 2414 143714156 143715767 0.000000e+00 2233
10 TraesCS4A01G331800 chr6D 93.686 2059 119 6 362 2414 111523673 111525726 0.000000e+00 3072
11 TraesCS4A01G331800 chr6D 92.655 354 19 3 8 360 111512196 111512543 9.960000e-139 503
12 TraesCS4A01G331800 chr7A 92.088 1504 104 6 919 2414 680112050 680113546 0.000000e+00 2104
13 TraesCS4A01G331800 chr7B 87.047 911 67 21 105 988 637648005 637648891 0.000000e+00 981
14 TraesCS4A01G331800 chr2D 93.761 561 29 5 8 566 584979242 584978686 0.000000e+00 837
15 TraesCS4A01G331800 chr3B 83.582 402 51 11 665 1064 750677708 750677320 1.760000e-96 363
16 TraesCS4A01G331800 chr3B 74.768 753 101 55 4 711 750678428 750677720 3.080000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G331800 chr4A 616304755 616307168 2413 True 4458 4458 100.000 1 2414 1 chr4A.!!$R1 2413
1 TraesCS4A01G331800 chr2A 597215995 597218399 2404 False 4272 4272 98.713 7 2414 1 chr2A.!!$F1 2407
2 TraesCS4A01G331800 chr6A 18029828 18032233 2405 False 4187 4187 98.130 16 2414 1 chr6A.!!$F1 2398
3 TraesCS4A01G331800 chr3A 911192 913410 2218 True 3882 3882 98.244 11 2230 1 chr3A.!!$R1 2219
4 TraesCS4A01G331800 chr3D 598248525 598250889 2364 False 3663 3663 94.449 10 2414 1 chr3D.!!$F1 2404
5 TraesCS4A01G331800 chr3D 181203318 181205586 2268 True 3227 3227 92.166 91 2414 1 chr3D.!!$R1 2323
6 TraesCS4A01G331800 chr4B 633799119 633801501 2382 False 3548 3548 93.476 8 2414 1 chr4B.!!$F1 2406
7 TraesCS4A01G331800 chr1B 517555686 517558072 2386 True 3478 3478 92.954 9 2414 1 chr1B.!!$R1 2405
8 TraesCS4A01G331800 chr6B 633372913 633375050 2137 False 3153 3153 93.380 8 2142 1 chr6B.!!$F2 2134
9 TraesCS4A01G331800 chr6B 143714156 143715767 1611 False 2233 2233 91.677 798 2414 1 chr6B.!!$F1 1616
10 TraesCS4A01G331800 chr6D 111523673 111525726 2053 False 3072 3072 93.686 362 2414 1 chr6D.!!$F2 2052
11 TraesCS4A01G331800 chr7A 680112050 680113546 1496 False 2104 2104 92.088 919 2414 1 chr7A.!!$F1 1495
12 TraesCS4A01G331800 chr7B 637648005 637648891 886 False 981 981 87.047 105 988 1 chr7B.!!$F1 883
13 TraesCS4A01G331800 chr2D 584978686 584979242 556 True 837 837 93.761 8 566 1 chr2D.!!$R1 558
14 TraesCS4A01G331800 chr3B 750677320 750678428 1108 True 309 363 79.175 4 1064 2 chr3B.!!$R1 1060

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
947 1103 2.093306 TGTTCCAGTGAGCGTTATGG 57.907 50.0 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1795 1956 2.240667 CCTTTCCCTCATCATGACCACT 59.759 50.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
746 887 2.158842 GCTCTCATATTGTCCAGGCAGT 60.159 50.000 0.0 0.0 0.0 4.40
947 1103 2.093306 TGTTCCAGTGAGCGTTATGG 57.907 50.000 0.0 0.0 0.0 2.74
1390 1548 2.785562 TGGGACGATGTAAACCAAAGG 58.214 47.619 0.0 0.0 0.0 3.11
1795 1956 1.203112 TGCATCAGGGGTTGGCTTTTA 60.203 47.619 0.0 0.0 0.0 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 505 1.066918 GGATGTATTCGTCGGGCGT 59.933 57.895 0.49 0.0 42.13 5.68
746 887 1.066858 GCACTTCTGTACTGCAGCCTA 60.067 52.381 15.27 0.0 44.66 3.93
1411 1570 2.418197 GCTTACCTCCGCAGTCATGTTA 60.418 50.000 0.00 0.0 0.00 2.41
1547 1707 7.062957 CCCTCCATTAACAAAACTATCTCCAT 58.937 38.462 0.00 0.0 0.00 3.41
1706 1866 0.396811 AGCCTTGTACTGTGTGGTCC 59.603 55.000 0.00 0.0 0.00 4.46
1795 1956 2.240667 CCTTTCCCTCATCATGACCACT 59.759 50.000 0.00 0.0 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.