Multiple sequence alignment - TraesCS4A01G316000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G316000 chr4A 100.000 2258 0 0 1 2258 606115328 606117585 0.000000e+00 4170
1 TraesCS4A01G316000 chr4A 98.459 2141 27 2 123 2258 606261719 606263858 0.000000e+00 3766
2 TraesCS4A01G316000 chr4A 98.550 2000 29 0 123 2122 606332650 606334649 0.000000e+00 3533
3 TraesCS4A01G316000 chr4A 98.477 1904 28 1 123 2026 605892324 605894226 0.000000e+00 3354
4 TraesCS4A01G316000 chr4A 98.564 1114 16 0 123 1236 606014329 606015442 0.000000e+00 1969
5 TraesCS4A01G316000 chr4A 98.037 866 17 0 123 988 606196816 606197681 0.000000e+00 1506
6 TraesCS4A01G316000 chr4A 99.215 764 6 0 1263 2026 606197676 606198439 0.000000e+00 1378
7 TraesCS4A01G316000 chr4A 99.194 496 4 0 1531 2026 606015442 606015937 0.000000e+00 894
8 TraesCS4A01G316000 chr4A 99.490 196 1 0 2063 2258 605894636 605894831 7.670000e-95 357
9 TraesCS4A01G316000 chr4A 98.507 201 3 0 2058 2258 606016035 606016235 2.760000e-94 355
10 TraesCS4A01G316000 chr4A 98.305 177 3 0 2082 2258 606198565 606198741 6.060000e-81 311
11 TraesCS4A01G316000 chr4A 99.167 120 1 0 1 120 606196204 606196323 1.360000e-52 217
12 TraesCS4A01G316000 chr4A 99.167 120 1 0 1 120 606261108 606261227 1.360000e-52 217
13 TraesCS4A01G316000 chr4A 99.167 120 1 0 1 120 606332038 606332157 1.360000e-52 217
14 TraesCS4A01G316000 chr4A 98.333 120 2 0 1 120 606013717 606013836 6.320000e-51 211
15 TraesCS4A01G316000 chr4A 97.414 116 3 0 1 116 605891715 605891830 4.920000e-47 198
16 TraesCS4A01G316000 chr5D 91.254 2001 166 8 123 2122 564736879 564738871 0.000000e+00 2717
17 TraesCS4A01G316000 chr5D 91.159 2002 167 7 123 2122 557334331 557336324 0.000000e+00 2708
18 TraesCS4A01G316000 chr5D 91.649 1413 111 4 713 2122 557397047 557398455 0.000000e+00 1949
19 TraesCS4A01G316000 chr5D 89.619 761 75 4 123 883 557315936 557316692 0.000000e+00 965
20 TraesCS4A01G316000 chr5D 89.983 589 55 4 123 711 557396321 557396905 0.000000e+00 758
21 TraesCS4A01G316000 chr5D 95.690 116 5 0 1 116 557333718 557333833 1.060000e-43 187
22 TraesCS4A01G316000 chr5D 95.690 116 5 0 1 116 557363365 557363480 1.060000e-43 187
23 TraesCS4A01G316000 chr5D 95.690 116 5 0 1 116 557395708 557395823 1.060000e-43 187
24 TraesCS4A01G316000 chrUn 92.571 1198 86 3 926 2122 414799020 414797825 0.000000e+00 1716
25 TraesCS4A01G316000 chrUn 94.958 119 6 0 1 119 402736722 402736604 1.060000e-43 187
26 TraesCS4A01G316000 chr5B 92.232 811 63 0 956 1766 708568617 708569427 0.000000e+00 1149
27 TraesCS4A01G316000 chr5B 92.109 811 64 0 956 1766 708607227 708608037 0.000000e+00 1144


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G316000 chr4A 606115328 606117585 2257 False 4170.000000 4170 100.000000 1 2258 1 chr4A.!!$F1 2257
1 TraesCS4A01G316000 chr4A 606261108 606263858 2750 False 1991.500000 3766 98.813000 1 2258 2 chr4A.!!$F5 2257
2 TraesCS4A01G316000 chr4A 606332038 606334649 2611 False 1875.000000 3533 98.858500 1 2122 2 chr4A.!!$F6 2121
3 TraesCS4A01G316000 chr4A 605891715 605894831 3116 False 1303.000000 3354 98.460333 1 2258 3 chr4A.!!$F2 2257
4 TraesCS4A01G316000 chr4A 606013717 606016235 2518 False 857.250000 1969 98.649500 1 2258 4 chr4A.!!$F3 2257
5 TraesCS4A01G316000 chr4A 606196204 606198741 2537 False 853.000000 1506 98.681000 1 2258 4 chr4A.!!$F4 2257
6 TraesCS4A01G316000 chr5D 564736879 564738871 1992 False 2717.000000 2717 91.254000 123 2122 1 chr5D.!!$F3 1999
7 TraesCS4A01G316000 chr5D 557333718 557336324 2606 False 1447.500000 2708 93.424500 1 2122 2 chr5D.!!$F4 2121
8 TraesCS4A01G316000 chr5D 557315936 557316692 756 False 965.000000 965 89.619000 123 883 1 chr5D.!!$F1 760
9 TraesCS4A01G316000 chr5D 557395708 557398455 2747 False 964.666667 1949 92.440667 1 2122 3 chr5D.!!$F5 2121
10 TraesCS4A01G316000 chrUn 414797825 414799020 1195 True 1716.000000 1716 92.571000 926 2122 1 chrUn.!!$R2 1196
11 TraesCS4A01G316000 chr5B 708568617 708569427 810 False 1149.000000 1149 92.232000 956 1766 1 chr5B.!!$F1 810
12 TraesCS4A01G316000 chr5B 708607227 708608037 810 False 1144.000000 1144 92.109000 956 1766 1 chr5B.!!$F2 810

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
402 895 0.179 CAGACAGGCCATAGTGGGAC 59.821 60.0 5.01 0.0 38.19 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2026 2663 0.614979 TCTTCCCTCCCTCTTCCACG 60.615 60.0 0.0 0.0 0.0 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 746 0.401395 TGGAGAGGCCGGGGATTTAT 60.401 55.000 2.18 0.0 40.66 1.40
388 881 6.768483 TCACAGAATATTTTGGACTCAGACA 58.232 36.000 10.46 0.0 0.00 3.41
402 895 0.179000 CAGACAGGCCATAGTGGGAC 59.821 60.000 5.01 0.0 38.19 4.46
427 920 6.633668 AACTTCAAGAGTAACATCGATTCG 57.366 37.500 0.00 0.0 37.72 3.34
528 1021 7.432148 ACATTACATATCCCAAGACAGTACA 57.568 36.000 0.00 0.0 0.00 2.90
1101 1735 0.530744 ACATACCATGCGACGAGTGT 59.469 50.000 0.00 0.0 0.00 3.55
1224 1858 4.980805 GACTTGTGCGTGCCCGGA 62.981 66.667 0.73 0.0 33.68 5.14
1412 2046 2.349886 CGAGTGCCTTGACTTAGCATTC 59.650 50.000 0.00 0.0 39.04 2.67
1813 2450 1.677576 TCGCGTAACTCCCACGATAAT 59.322 47.619 5.77 0.0 41.91 1.28
2026 2663 5.106515 GCTCATAGAAGTCCAAGAAACCAAC 60.107 44.000 0.00 0.0 0.00 3.77
2038 2675 0.841289 AAACCAACGTGGAAGAGGGA 59.159 50.000 10.46 0.0 40.96 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 3.116300 CTCGACAATATGGAGTTGGTCG 58.884 50.000 0.00 0.0 34.51 4.79
329 822 2.426522 GCCAACACTGATAGCTGAACA 58.573 47.619 0.00 0.0 0.00 3.18
388 881 2.570386 AGTTAGTCCCACTATGGCCT 57.430 50.000 3.32 0.0 35.79 5.19
402 895 7.696872 TCGAATCGATGTTACTCTTGAAGTTAG 59.303 37.037 0.00 0.0 39.55 2.34
1813 2450 3.985019 TCTTTAAATGGGCTACGTGGA 57.015 42.857 1.81 0.0 0.00 4.02
2026 2663 0.614979 TCTTCCCTCCCTCTTCCACG 60.615 60.000 0.00 0.0 0.00 4.94
2038 2675 3.264706 GGCTTCTCCTAACTTTCTTCCCT 59.735 47.826 0.00 0.0 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.