Multiple sequence alignment - TraesCS4A01G303000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G303000 chr4A 100.000 4301 0 0 1 4301 599159592 599155292 0.000000e+00 7943
1 TraesCS4A01G303000 chr4A 99.140 4303 33 4 1 4301 599248671 599244371 0.000000e+00 7738
2 TraesCS4A01G303000 chr4A 98.884 4303 41 7 1 4301 599126631 599122334 0.000000e+00 7673
3 TraesCS4A01G303000 chr4A 94.561 2427 121 8 1881 4301 599178570 599176149 0.000000e+00 3740
4 TraesCS4A01G303000 chr4A 94.518 2426 123 8 1881 4301 599221997 599219577 0.000000e+00 3735
5 TraesCS4A01G303000 chr4A 94.217 2438 119 11 1881 4301 599101191 599098759 0.000000e+00 3701
6 TraesCS4A01G303000 chr4A 94.319 2165 118 4 2140 4301 599083271 599081109 0.000000e+00 3312
7 TraesCS4A01G303000 chr4A 94.330 2046 109 6 2061 4103 599144528 599142487 0.000000e+00 3129
8 TraesCS4A01G303000 chr4A 93.523 1899 101 15 1 1893 599085417 599083535 0.000000e+00 2806
9 TraesCS4A01G303000 chr4A 93.647 1889 100 13 1 1883 599103141 599101267 0.000000e+00 2806
10 TraesCS4A01G303000 chr4A 93.594 1889 101 13 1 1883 599180520 599178646 0.000000e+00 2800
11 TraesCS4A01G303000 chr4A 93.542 1889 102 13 1 1883 599223947 599222073 0.000000e+00 2795
12 TraesCS4A01G303000 chr4A 93.224 1889 104 15 1 1883 599147357 599145487 0.000000e+00 2758
13 TraesCS4A01G303000 chrUn 99.431 3339 15 4 965 4301 216675826 216672490 0.000000e+00 6058
14 TraesCS4A01G303000 chrUn 93.383 1738 92 14 151 1883 360633603 360631884 0.000000e+00 2551
15 TraesCS4A01G303000 chrUn 93.561 1056 59 7 1 1053 216652828 216651779 0.000000e+00 1565
16 TraesCS4A01G303000 chrUn 94.293 368 17 3 3937 4301 360632885 360632519 1.040000e-155 560
17 TraesCS4A01G303000 chr4B 91.286 2100 131 11 1881 3933 7354718 7356812 0.000000e+00 2817
18 TraesCS4A01G303000 chr6A 94.957 1388 62 2 2921 4301 593024889 593023503 0.000000e+00 2169


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G303000 chr4A 599155292 599159592 4300 True 7943.0 7943 100.0000 1 4301 1 chr4A.!!$R2 4300
1 TraesCS4A01G303000 chr4A 599244371 599248671 4300 True 7738.0 7738 99.1400 1 4301 1 chr4A.!!$R3 4300
2 TraesCS4A01G303000 chr4A 599122334 599126631 4297 True 7673.0 7673 98.8840 1 4301 1 chr4A.!!$R1 4300
3 TraesCS4A01G303000 chr4A 599176149 599180520 4371 True 3270.0 3740 94.0775 1 4301 2 chr4A.!!$R7 4300
4 TraesCS4A01G303000 chr4A 599219577 599223947 4370 True 3265.0 3735 94.0300 1 4301 2 chr4A.!!$R8 4300
5 TraesCS4A01G303000 chr4A 599098759 599103141 4382 True 3253.5 3701 93.9320 1 4301 2 chr4A.!!$R5 4300
6 TraesCS4A01G303000 chr4A 599081109 599085417 4308 True 3059.0 3312 93.9210 1 4301 2 chr4A.!!$R4 4300
7 TraesCS4A01G303000 chr4A 599142487 599147357 4870 True 2943.5 3129 93.7770 1 4103 2 chr4A.!!$R6 4102
8 TraesCS4A01G303000 chrUn 216672490 216675826 3336 True 6058.0 6058 99.4310 965 4301 1 chrUn.!!$R2 3336
9 TraesCS4A01G303000 chrUn 216651779 216652828 1049 True 1565.0 1565 93.5610 1 1053 1 chrUn.!!$R1 1052
10 TraesCS4A01G303000 chrUn 360631884 360633603 1719 True 1555.5 2551 93.8380 151 4301 2 chrUn.!!$R3 4150
11 TraesCS4A01G303000 chr4B 7354718 7356812 2094 False 2817.0 2817 91.2860 1881 3933 1 chr4B.!!$F1 2052
12 TraesCS4A01G303000 chr6A 593023503 593024889 1386 True 2169.0 2169 94.9570 2921 4301 1 chr6A.!!$R1 1380

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1475 1482 6.757947 TCAAGTTTAGTTGCGTTTAGTGTAGT 59.242 34.615 0.0 0.0 0.0 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3371 4278 4.457949 CCCTTTAAAAACCGCTACATCAGT 59.542 41.667 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1475 1482 6.757947 TCAAGTTTAGTTGCGTTTAGTGTAGT 59.242 34.615 0.00 0.00 0.00 2.73
1926 2097 1.089112 GCCAATGGCCATTTTTCTGC 58.911 50.000 28.68 20.02 44.06 4.26
2746 3624 7.303182 TCTCAATTCTGTTAACCTCTTCAGA 57.697 36.000 2.48 0.00 35.54 3.27
3371 4278 4.729227 TTATGCGTTCCATGTGTCTCTA 57.271 40.909 0.00 0.00 35.34 2.43
3504 4428 6.975772 GTCAGTGTGAAGTCCATATTCTAGTC 59.024 42.308 0.00 0.00 0.00 2.59
3813 4737 1.347707 TCGAGGGATCACAAAGCTGTT 59.652 47.619 0.00 0.00 31.64 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
416 419 4.151689 CGAGAGCGTTCCATCACTTTTTAA 59.848 41.667 0.00 0.00 0.00 1.52
639 642 0.891904 GTTAGCTTGGAAACGGCCCA 60.892 55.000 0.00 0.00 33.10 5.36
808 813 2.098680 GACTGAGCGGTCGAGACG 59.901 66.667 17.10 5.17 0.00 4.18
935 940 1.611977 CACAACCACACGACTAGAGGA 59.388 52.381 0.00 0.00 0.00 3.71
1636 1645 4.951254 TCAATGTCGTGGACAAACTAGAA 58.049 39.130 2.20 0.00 45.96 2.10
1926 2097 2.185004 ACACCGTTCCAATGGAGAAG 57.815 50.000 0.86 0.00 38.48 2.85
2746 3624 7.215789 TGCAAAAATACCACATTGTCAGATTT 58.784 30.769 0.00 0.00 0.00 2.17
3371 4278 4.457949 CCCTTTAAAAACCGCTACATCAGT 59.542 41.667 0.00 0.00 0.00 3.41
3504 4428 1.868997 GGCAACACATCCACGTCAG 59.131 57.895 0.00 0.00 0.00 3.51
3813 4737 1.947146 CACGTTGTCTCGCGAACCA 60.947 57.895 11.33 6.78 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.