Multiple sequence alignment - TraesCS4A01G302900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G302900 chr4A 100.000 4441 0 0 1 4441 599126774 599122334 0.000000e+00 8202
1 TraesCS4A01G302900 chr4A 98.898 4446 42 7 1 4441 599159735 599155292 0.000000e+00 7932
2 TraesCS4A01G302900 chr4A 98.830 4444 49 3 1 4441 599248814 599244371 0.000000e+00 7915
3 TraesCS4A01G302900 chr4A 94.433 2425 127 6 2022 4441 599178570 599176149 0.000000e+00 3723
4 TraesCS4A01G302900 chr4A 94.389 2424 129 6 2022 4441 599221997 599219577 0.000000e+00 3716
5 TraesCS4A01G302900 chr4A 94.089 2436 125 9 2022 4441 599101191 599098759 0.000000e+00 3683
6 TraesCS4A01G302900 chr4A 94.129 2163 125 1 2281 4441 599083271 599081109 0.000000e+00 3290
7 TraesCS4A01G302900 chr4A 94.227 2044 114 3 2202 4243 599144528 599142487 0.000000e+00 3118
8 TraesCS4A01G302900 chr4A 93.648 2031 107 15 1 2024 599103282 599101267 0.000000e+00 3016
9 TraesCS4A01G302900 chr4A 93.599 2031 108 16 1 2024 599180661 599178646 0.000000e+00 3011
10 TraesCS4A01G302900 chr4A 93.550 2031 109 16 1 2024 599224088 599222073 0.000000e+00 3005
11 TraesCS4A01G302900 chr4A 93.386 2041 111 17 1 2034 599085558 599083535 0.000000e+00 3000
12 TraesCS4A01G302900 chr4A 93.255 2031 111 17 1 2024 599147498 599145487 0.000000e+00 2968
13 TraesCS4A01G302900 chrUn 99.071 3337 29 2 1107 4441 216675826 216672490 0.000000e+00 5989
14 TraesCS4A01G302900 chrUn 93.667 1737 87 15 294 2024 360633603 360631884 0.000000e+00 2577
15 TraesCS4A01G302900 chrUn 93.661 1199 64 10 1 1195 216652969 216651779 0.000000e+00 1783
16 TraesCS4A01G302900 chrUn 93.478 368 20 3 4077 4441 360632885 360632519 1.090000e-150 544
17 TraesCS4A01G302900 chr4B 91.238 2100 131 11 2022 4073 7354718 7356812 0.000000e+00 2809
18 TraesCS4A01G302900 chr6A 95.029 1388 61 2 3061 4441 593024889 593023503 0.000000e+00 2174
19 TraesCS4A01G302900 chr4D 92.563 1358 93 6 2022 3376 4418250 4419602 0.000000e+00 1941


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G302900 chr4A 599122334 599126774 4440 True 8202.0 8202 100.0000 1 4441 1 chr4A.!!$R1 4440
1 TraesCS4A01G302900 chr4A 599155292 599159735 4443 True 7932.0 7932 98.8980 1 4441 1 chr4A.!!$R2 4440
2 TraesCS4A01G302900 chr4A 599244371 599248814 4443 True 7915.0 7915 98.8300 1 4441 1 chr4A.!!$R3 4440
3 TraesCS4A01G302900 chr4A 599176149 599180661 4512 True 3367.0 3723 94.0160 1 4441 2 chr4A.!!$R7 4440
4 TraesCS4A01G302900 chr4A 599219577 599224088 4511 True 3360.5 3716 93.9695 1 4441 2 chr4A.!!$R8 4440
5 TraesCS4A01G302900 chr4A 599098759 599103282 4523 True 3349.5 3683 93.8685 1 4441 2 chr4A.!!$R5 4440
6 TraesCS4A01G302900 chr4A 599081109 599085558 4449 True 3145.0 3290 93.7575 1 4441 2 chr4A.!!$R4 4440
7 TraesCS4A01G302900 chr4A 599142487 599147498 5011 True 3043.0 3118 93.7410 1 4243 2 chr4A.!!$R6 4242
8 TraesCS4A01G302900 chrUn 216672490 216675826 3336 True 5989.0 5989 99.0710 1107 4441 1 chrUn.!!$R2 3334
9 TraesCS4A01G302900 chrUn 216651779 216652969 1190 True 1783.0 1783 93.6610 1 1195 1 chrUn.!!$R1 1194
10 TraesCS4A01G302900 chrUn 360631884 360633603 1719 True 1560.5 2577 93.5725 294 4441 2 chrUn.!!$R3 4147
11 TraesCS4A01G302900 chr4B 7354718 7356812 2094 False 2809.0 2809 91.2380 2022 4073 1 chr4B.!!$F1 2051
12 TraesCS4A01G302900 chr6A 593023503 593024889 1386 True 2174.0 2174 95.0290 3061 4441 1 chr6A.!!$R1 1380
13 TraesCS4A01G302900 chr4D 4418250 4419602 1352 False 1941.0 1941 92.5630 2022 3376 1 chr4D.!!$F1 1354

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1684 1689 7.703058 ATTGTTGTCCTTTTCGGAATATTCT 57.297 32.0 14.95 0.0 45.32 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3487 4397 3.871006 GAGACACATGGAACGCATAATGA 59.129 43.478 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1684 1689 7.703058 ATTGTTGTCCTTTTCGGAATATTCT 57.297 32.000 14.95 0.0 45.32 2.40
1934 1944 9.627395 GCTGAGTTTAGTCATATATCGTGTAAT 57.373 33.333 0.00 0.0 0.00 1.89
1988 1999 0.754217 TCGTATAGCTTGGCGAGGGT 60.754 55.000 3.44 0.0 0.00 4.34
2146 2317 0.323629 ATGGACGTGATTCGGGTGTT 59.676 50.000 0.00 0.0 44.69 3.32
2192 2363 5.834169 TGATTGTAGTTGTGTCTCGTGTAA 58.166 37.500 0.00 0.0 0.00 2.41
2422 3297 4.217767 AGTTTGCGAAGTTCCTAATTTCCC 59.782 41.667 0.00 0.0 0.00 3.97
2536 3413 3.644966 ACAAGGGTCAGAACTCAACAA 57.355 42.857 0.00 0.0 0.00 2.83
2660 3537 5.938125 AGCTCATACCAATCTAACGTTGTTT 59.062 36.000 11.99 0.0 0.00 2.83
3487 4397 1.690283 GGCCCCATGCAATCCCTTT 60.690 57.895 0.00 0.0 43.89 3.11
3622 4549 1.590698 TGTTGTCGTGTGTTGATGTCG 59.409 47.619 0.00 0.0 0.00 4.35
4114 5042 1.792367 CATATCACCGGCATGTACACG 59.208 52.381 0.00 0.0 0.00 4.49
4249 5186 0.904865 ATTCGAGGAGCTGTGGGACA 60.905 55.000 0.00 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 3.217231 CGGAGGCCGTTAGGTCAT 58.783 61.111 0.0 0.0 46.92 3.06
1684 1689 9.276590 CACAGAATAGCAGATCATTAATACCAA 57.723 33.333 0.0 0.0 0.00 3.67
1934 1944 6.985653 TTGGGAAGAATACCAACAATTTCA 57.014 33.333 0.0 0.0 41.56 2.69
2192 2363 3.869246 GTCATGAATACCGACAATTCCGT 59.131 43.478 0.0 0.0 33.28 4.69
2660 3537 8.349983 GTGAAAAAGCAAATCAGGTTACTTCTA 58.650 33.333 0.0 0.0 0.00 2.10
3000 3879 6.828273 CACAATCCAACATTAGGGACATAAGA 59.172 38.462 0.0 0.0 35.67 2.10
3008 3887 5.445069 TGGTATCACAATCCAACATTAGGG 58.555 41.667 0.0 0.0 0.00 3.53
3487 4397 3.871006 GAGACACATGGAACGCATAATGA 59.129 43.478 0.0 0.0 0.00 2.57
3622 4549 5.812642 CACACTAGAATATGGACTTCACACC 59.187 44.000 0.0 0.0 0.00 4.16
3984 4911 3.489059 CCAATGCAAATACACCTAAGCCG 60.489 47.826 0.0 0.0 0.00 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.