Multiple sequence alignment - TraesCS4A01G287000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G287000 chr4A 100.000 2973 0 0 1 2973 592363093 592360121 0 5491
1 TraesCS4A01G287000 chr4A 97.949 2974 59 2 1 2973 591346350 591349322 0 5153
2 TraesCS4A01G287000 chr4A 97.579 2974 66 5 1 2973 591415869 591418837 0 5088
3 TraesCS4A01G287000 chr4A 97.075 2974 83 4 1 2973 591292585 591295555 0 5007
4 TraesCS4A01G287000 chr4A 96.940 2974 88 3 1 2973 591673855 591676826 0 4985
5 TraesCS4A01G287000 chr4A 96.644 2980 91 3 1 2973 592336771 592333794 0 4940
6 TraesCS4A01G287000 chr4A 98.131 2033 37 1 1 2033 592928425 592926394 0 3542
7 TraesCS4A01G287000 chr4A 97.838 1943 40 1 1 1943 592310814 592308874 0 3354
8 TraesCS4A01G287000 chr4A 97.478 1943 47 2 1 1943 591285565 591283625 0 3315
9 TraesCS4A01G287000 chr4A 97.789 1402 31 0 1572 2973 592926383 592924982 0 2418
10 TraesCS4A01G287000 chr4A 97.903 1383 28 1 1 1383 592639041 592637660 0 2392
11 TraesCS4A01G287000 chr4A 97.566 945 23 0 2029 2973 592636718 592635774 0 1618
12 TraesCS4A01G287000 chr4A 97.040 946 28 0 2028 2973 592308466 592307521 0 1592
13 TraesCS4A01G287000 chr4A 97.326 935 25 0 2039 2973 591283300 591282366 0 1589
14 TraesCS4A01G287000 chr4D 90.464 1573 128 12 437 1992 10828588 10830155 0 2054


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G287000 chr4A 592360121 592363093 2972 True 5491 5491 100.0000 1 2973 1 chr4A.!!$R2 2972
1 TraesCS4A01G287000 chr4A 591346350 591349322 2972 False 5153 5153 97.9490 1 2973 1 chr4A.!!$F2 2972
2 TraesCS4A01G287000 chr4A 591415869 591418837 2968 False 5088 5088 97.5790 1 2973 1 chr4A.!!$F3 2972
3 TraesCS4A01G287000 chr4A 591292585 591295555 2970 False 5007 5007 97.0750 1 2973 1 chr4A.!!$F1 2972
4 TraesCS4A01G287000 chr4A 591673855 591676826 2971 False 4985 4985 96.9400 1 2973 1 chr4A.!!$F4 2972
5 TraesCS4A01G287000 chr4A 592333794 592336771 2977 True 4940 4940 96.6440 1 2973 1 chr4A.!!$R1 2972
6 TraesCS4A01G287000 chr4A 592924982 592928425 3443 True 2980 3542 97.9600 1 2973 2 chr4A.!!$R6 2972
7 TraesCS4A01G287000 chr4A 592307521 592310814 3293 True 2473 3354 97.4390 1 2973 2 chr4A.!!$R4 2972
8 TraesCS4A01G287000 chr4A 591282366 591285565 3199 True 2452 3315 97.4020 1 2973 2 chr4A.!!$R3 2972
9 TraesCS4A01G287000 chr4A 592635774 592639041 3267 True 2005 2392 97.7345 1 2973 2 chr4A.!!$R5 2972
10 TraesCS4A01G287000 chr4D 10828588 10830155 1567 False 2054 2054 90.4640 437 1992 1 chr4D.!!$F1 1555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
868 875 2.490903 GTTTGTGGCATGAAGAGCTCAT 59.509 45.455 17.77 2.97 46.25 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2069 2563 0.393267 CCCCTACGGCGATTTTTCCA 60.393 55.0 16.62 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 470 6.565234 TGTTCCACGCAAGAATTTTAAAAGA 58.435 32.000 6.79 0.00 43.62 2.52
868 875 2.490903 GTTTGTGGCATGAAGAGCTCAT 59.509 45.455 17.77 2.97 46.25 2.90
889 896 4.871871 TGGGGATAATGAGTTTGGCTAA 57.128 40.909 0.00 0.00 0.00 3.09
1004 1017 1.949799 AGCTCCTTCATCCTCACACT 58.050 50.000 0.00 0.00 0.00 3.55
1026 1039 2.703007 GCACCACAATCTCTCCTCCTAT 59.297 50.000 0.00 0.00 0.00 2.57
1209 1222 4.710324 GACTGAGGAGTAGAAGCTAGCTA 58.290 47.826 19.70 0.00 30.16 3.32
1331 1344 1.835927 GCAGCTGGTCTCTTGAGGGT 61.836 60.000 17.12 0.00 0.00 4.34
1410 1423 2.116125 GGGCCTCACACAAAGCCT 59.884 61.111 0.84 0.00 45.07 4.58
1710 1723 3.992641 TCCCTGCCCTCGAGTCCA 61.993 66.667 12.31 6.87 0.00 4.02
1712 1725 2.997315 CCTGCCCTCGAGTCCACA 60.997 66.667 12.31 2.87 0.00 4.17
2510 3004 3.135712 TGTCAAACACTGGCTCTTCCTTA 59.864 43.478 0.00 0.00 35.26 2.69
2520 3014 2.298729 GGCTCTTCCTTATCGCTCTCAT 59.701 50.000 0.00 0.00 0.00 2.90
2538 3032 4.157105 TCTCATTGATCATGTTGTGCAAGG 59.843 41.667 0.00 0.00 34.06 3.61
2590 3084 3.903714 TGATCTTTCAACCAGGTCAGAGA 59.096 43.478 0.00 0.00 27.76 3.10
2792 3286 1.078426 GTAGTGGCGCCCATTGACT 60.078 57.895 26.77 22.23 35.28 3.41
2804 3298 3.319122 GCCCATTGACTTTGAAGTTCACT 59.681 43.478 4.68 0.00 39.88 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
387 389 2.732282 GCAAGGATCGCAAGGCTAAAAC 60.732 50.000 0.00 0.00 38.47 2.43
468 470 8.062536 AGAGATCATAGTTAGGGAAGTACTTGT 58.937 37.037 14.14 0.00 0.00 3.16
731 738 4.927267 TGTGATTGGACATAAGGGAAGT 57.073 40.909 0.00 0.00 0.00 3.01
868 875 4.871871 TTAGCCAAACTCATTATCCCCA 57.128 40.909 0.00 0.00 0.00 4.96
1004 1017 0.615331 GGAGGAGAGATTGTGGTGCA 59.385 55.000 0.00 0.00 0.00 4.57
1026 1039 2.130272 TGGTTGGTTTGCACACTACA 57.870 45.000 2.52 0.00 0.00 2.74
1121 1134 4.753662 TACGAGACGGCTGGCCCT 62.754 66.667 0.00 0.00 0.00 5.19
1331 1344 2.725641 CTGGACGTGTCGGTGACA 59.274 61.111 0.00 0.00 40.50 3.58
1847 1869 1.270839 GCTCAGACTTTGTAGCCACCA 60.271 52.381 0.00 0.00 0.00 4.17
2069 2563 0.393267 CCCCTACGGCGATTTTTCCA 60.393 55.000 16.62 0.00 0.00 3.53
2436 2930 3.679389 CCAAAGTTGATCACCAGCTACT 58.321 45.455 0.00 0.00 35.13 2.57
2510 3004 4.272748 CACAACATGATCAATGAGAGCGAT 59.727 41.667 0.00 0.00 38.72 4.58
2520 3014 3.004629 GTCACCTTGCACAACATGATCAA 59.995 43.478 0.00 0.00 0.00 2.57
2538 3032 0.512952 GTCATGACTTGCCGTGTCAC 59.487 55.000 18.83 0.00 45.57 3.67
2590 3084 1.513858 TGTTGTTGTCTGGTACCCCT 58.486 50.000 10.07 0.00 0.00 4.79
2792 3286 2.172505 TGCTCCTCCAGTGAACTTCAAA 59.827 45.455 0.00 0.00 0.00 2.69
2804 3298 1.003580 GTTGAAGGTCATGCTCCTCCA 59.996 52.381 9.18 1.42 33.76 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.