Multiple sequence alignment - TraesCS4A01G286800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G286800 chr4A 100.000 1977 0 0 1 1977 592310850 592308874 0 3651
1 TraesCS4A01G286800 chr4A 99.393 1978 11 1 1 1977 592928461 592926484 0 3585
2 TraesCS4A01G286800 chr4A 98.129 1978 36 1 1 1977 591346315 591348292 0 3446
3 TraesCS4A01G286800 chr4A 97.927 1978 38 2 1 1977 591415834 591417809 0 3422
4 TraesCS4A01G286800 chr4A 97.878 1979 40 1 1 1977 592363129 592361151 0 3421
5 TraesCS4A01G286800 chr4A 97.725 1978 43 2 1 1977 591285601 591283625 0 3402
6 TraesCS4A01G286800 chr4A 97.624 1978 44 3 1 1977 591292549 591294524 0 3389
7 TraesCS4A01G286800 chr4A 97.422 1978 50 1 1 1977 591673819 591675796 0 3369
8 TraesCS4A01G286800 chr4A 97.371 1978 50 2 1 1977 592336807 592334831 0 3363
9 TraesCS4A01G286800 chr4A 99.224 1418 10 1 1 1417 592639077 592637660 0 2556
10 TraesCS4A01G286800 chr4A 100.000 517 0 0 2384 2900 592308467 592307951 0 955
11 TraesCS4A01G286800 chr4A 99.417 515 3 0 2386 2900 592636718 592636204 0 935
12 TraesCS4A01G286800 chr4A 99.225 516 4 0 2385 2900 592925927 592925412 0 931
13 TraesCS4A01G286800 chr4A 98.256 516 9 0 2385 2900 591348377 591348892 0 904
14 TraesCS4A01G286800 chr4A 97.485 517 13 0 2384 2900 592334740 592334224 0 883
15 TraesCS4A01G286800 chr4A 97.292 517 14 0 2384 2900 591294609 591295125 0 878
16 TraesCS4A01G286800 chr4A 97.292 517 11 3 2384 2900 591417894 591418407 0 874
17 TraesCS4A01G286800 chr4A 97.426 505 13 0 2396 2900 591283300 591282796 0 861
18 TraesCS4A01G286800 chr4A 96.705 516 17 0 2385 2900 592361066 592360551 0 859
19 TraesCS4A01G286800 chr4A 96.705 516 16 1 2385 2900 591675882 591676396 0 857
20 TraesCS4A01G286800 chr4D 90.879 1524 115 12 473 1977 10810819 10812337 0 2023


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G286800 chr4A 592307951 592310850 2899 True 2303.0 3651 100.0000 1 2900 2 chr4A.!!$R2 2899
1 TraesCS4A01G286800 chr4A 592925412 592928461 3049 True 2258.0 3585 99.3090 1 2900 2 chr4A.!!$R6 2899
2 TraesCS4A01G286800 chr4A 591346315 591348892 2577 False 2175.0 3446 98.1925 1 2900 2 chr4A.!!$F2 2899
3 TraesCS4A01G286800 chr4A 591415834 591418407 2573 False 2148.0 3422 97.6095 1 2900 2 chr4A.!!$F3 2899
4 TraesCS4A01G286800 chr4A 592360551 592363129 2578 True 2140.0 3421 97.2915 1 2900 2 chr4A.!!$R4 2899
5 TraesCS4A01G286800 chr4A 591292549 591295125 2576 False 2133.5 3389 97.4580 1 2900 2 chr4A.!!$F1 2899
6 TraesCS4A01G286800 chr4A 591282796 591285601 2805 True 2131.5 3402 97.5755 1 2900 2 chr4A.!!$R1 2899
7 TraesCS4A01G286800 chr4A 592334224 592336807 2583 True 2123.0 3363 97.4280 1 2900 2 chr4A.!!$R3 2899
8 TraesCS4A01G286800 chr4A 591673819 591676396 2577 False 2113.0 3369 97.0635 1 2900 2 chr4A.!!$F4 2899
9 TraesCS4A01G286800 chr4A 592636204 592639077 2873 True 1745.5 2556 99.3205 1 2900 2 chr4A.!!$R5 2899
10 TraesCS4A01G286800 chr4D 10810819 10812337 1518 False 2023.0 2023 90.8790 473 1977 1 chr4D.!!$F1 1504

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
654 656 1.20258 AGAGCATCCCATACAGTTCGC 60.203 52.381 0.0 0.0 33.66 4.7 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2534 2705 1.473278 GTTCCAAACCACACCGAACAA 59.527 47.619 0.0 0.0 34.36 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
621 622 5.012239 TCAAGCATGGATATATTTGGAGGC 58.988 41.667 0.0 0.0 0.00 4.70
654 656 1.202580 AGAGCATCCCATACAGTTCGC 60.203 52.381 0.0 0.0 33.66 4.70
1085 1096 1.067283 TGTGCAAACCAACCAACACAG 60.067 47.619 0.0 0.0 33.41 3.66
1604 1616 3.592814 CCAGATCGACGCCGCCTA 61.593 66.667 0.0 0.0 35.37 3.93
2606 2777 9.642312 CACATAGTTCATCAACGAAATCAATAG 57.358 33.333 0.0 0.0 37.61 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
621 622 1.139853 GATGCTCTCCCCTGTACCAAG 59.860 57.143 0.00 0.00 0.00 3.61
654 656 2.502538 TCGGGGTAATTACCTTCCAGTG 59.497 50.000 29.26 13.43 45.72 3.66
1085 1096 1.471684 CCATTGCTGCTTCTCTTGTCC 59.528 52.381 0.00 0.00 0.00 4.02
1604 1616 4.193893 TGGTGGCTGCAGTGCTGT 62.194 61.111 21.31 0.00 0.00 4.40
2534 2705 1.473278 GTTCCAAACCACACCGAACAA 59.527 47.619 0.00 0.00 34.36 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.