Multiple sequence alignment - TraesCS4A01G285400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G285400 chr4A 100.000 2661 0 0 1 2661 591560460 591557800 0 4915
1 TraesCS4A01G285400 chr4A 98.125 2666 44 5 1 2661 592482777 592485441 0 4641
2 TraesCS4A01G285400 chr4A 98.050 2666 46 5 1 2661 592761583 592764247 0 4630
3 TraesCS4A01G285400 chr4A 97.862 2666 50 6 1 2661 593049661 593052324 0 4601
4 TraesCS4A01G285400 chr3A 97.824 2666 48 8 1 2661 42788383 42785723 0 4593
5 TraesCS4A01G285400 chr6A 97.677 2669 51 9 1 2661 40643544 40640879 0 4575
6 TraesCS4A01G285400 chr7A 97.637 2666 56 6 1 2661 724107975 724105312 0 4567
7 TraesCS4A01G285400 chr5A 97.600 2667 57 6 1 2661 624950902 624948237 0 4564
8 TraesCS4A01G285400 chr2B 97.390 2682 47 14 1 2661 608457617 608460296 0 4543
9 TraesCS4A01G285400 chr2B 97.313 2680 51 11 1 2661 772252240 772249563 0 4530
10 TraesCS4A01G285400 chr7B 97.054 2682 57 14 1 2661 194130148 194127468 0 4495
11 TraesCS4A01G285400 chr7B 97.054 2682 57 13 1 2661 666524111 666526791 0 4495


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G285400 chr4A 591557800 591560460 2660 True 4915 4915 100.000 1 2661 1 chr4A.!!$R1 2660
1 TraesCS4A01G285400 chr4A 592482777 592485441 2664 False 4641 4641 98.125 1 2661 1 chr4A.!!$F1 2660
2 TraesCS4A01G285400 chr4A 592761583 592764247 2664 False 4630 4630 98.050 1 2661 1 chr4A.!!$F2 2660
3 TraesCS4A01G285400 chr4A 593049661 593052324 2663 False 4601 4601 97.862 1 2661 1 chr4A.!!$F3 2660
4 TraesCS4A01G285400 chr3A 42785723 42788383 2660 True 4593 4593 97.824 1 2661 1 chr3A.!!$R1 2660
5 TraesCS4A01G285400 chr6A 40640879 40643544 2665 True 4575 4575 97.677 1 2661 1 chr6A.!!$R1 2660
6 TraesCS4A01G285400 chr7A 724105312 724107975 2663 True 4567 4567 97.637 1 2661 1 chr7A.!!$R1 2660
7 TraesCS4A01G285400 chr5A 624948237 624950902 2665 True 4564 4564 97.600 1 2661 1 chr5A.!!$R1 2660
8 TraesCS4A01G285400 chr2B 608457617 608460296 2679 False 4543 4543 97.390 1 2661 1 chr2B.!!$F1 2660
9 TraesCS4A01G285400 chr2B 772249563 772252240 2677 True 4530 4530 97.313 1 2661 1 chr2B.!!$R1 2660
10 TraesCS4A01G285400 chr7B 194127468 194130148 2680 True 4495 4495 97.054 1 2661 1 chr7B.!!$R1 2660
11 TraesCS4A01G285400 chr7B 666524111 666526791 2680 False 4495 4495 97.054 1 2661 1 chr7B.!!$F1 2660

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
753 761 1.694169 CCCCCTCCTGGCTGTACAT 60.694 63.158 0.0 0.0 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2325 2358 1.480137 CTAGCTAGTTGCAGAGTGGCT 59.52 52.381 12.92 15.15 46.09 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 2.364324 TCTCGAAACTACTTGGTGCAGT 59.636 45.455 0.00 0.00 0.00 4.40
292 294 4.581309 ATGCCTCCTCAATCAAAGAAGA 57.419 40.909 0.00 0.00 0.00 2.87
753 761 1.694169 CCCCCTCCTGGCTGTACAT 60.694 63.158 0.00 0.00 0.00 2.29
1078 1086 2.642171 ACTCCCAATGGACCTACAGA 57.358 50.000 0.00 0.00 35.03 3.41
1146 1154 4.647399 TCCAAAACAAAAACTAGGGTGAGG 59.353 41.667 0.00 0.00 0.00 3.86
1209 1217 2.738521 CTGCCTAGTTGCGTGCGT 60.739 61.111 0.00 0.00 0.00 5.24
1806 1822 7.132694 CTTGAATTAGTTCATGCACTGTGTA 57.867 36.000 8.37 5.19 43.49 2.90
2102 2121 5.451937 CCAATCATACGTCAGCTTCTTCCTA 60.452 44.000 0.00 0.00 0.00 2.94
2156 2175 1.282157 AGTTGGCTACCATTCCACTCC 59.718 52.381 0.00 0.00 31.53 3.85
2195 2214 3.813166 CGAACAACCCACACTCATTACTT 59.187 43.478 0.00 0.00 0.00 2.24
2276 2309 5.995565 ACTTATGTCCTACTGTGCAACTA 57.004 39.130 0.00 0.00 38.04 2.24
2308 2341 3.359033 ACTGCAACTCATTATGTGCCAT 58.641 40.909 4.27 0.00 0.00 4.40
2325 2358 4.155826 GTGCCATTGTGCAACTACTTATGA 59.844 41.667 0.00 0.00 44.11 2.15
2404 2437 7.026562 CAGATTGAAGACTAGTACTGTGTCTG 58.973 42.308 24.41 13.10 40.44 3.51
2533 2566 9.093970 CTTTGGTACGTCAATGTCAATAATCTA 57.906 33.333 0.00 0.00 0.00 1.98
2605 2638 2.375345 CCCCCGCAATGGTAGAGGT 61.375 63.158 0.00 0.00 35.15 3.85
2656 2689 4.023707 CGTCCTGCTTGAATCAAGAACTTT 60.024 41.667 25.54 0.00 43.42 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 0.840722 GAACCCTCCTCCACCCTTGA 60.841 60.000 0.00 0.00 0.00 3.02
292 294 9.041354 GTATATCATGTTCCTCTCCCTTATCTT 57.959 37.037 0.00 0.00 0.00 2.40
1078 1086 2.284995 GAGCCCCCTGAGTCCTGT 60.285 66.667 0.00 0.00 0.00 4.00
1146 1154 7.855545 CACTATGATATGTGCAACTAAAGTCC 58.144 38.462 0.00 0.00 38.04 3.85
1209 1217 5.376625 AGCTTGATCCTCAAACTAACACAA 58.623 37.500 0.00 0.00 35.73 3.33
2102 2121 3.397955 ACCCCAAGGAAGTACTCAACATT 59.602 43.478 0.00 0.00 36.73 2.71
2156 2175 2.173382 GCACTGCTTAACGCCACG 59.827 61.111 0.00 0.00 38.05 4.94
2276 2309 4.137116 TGAGTTGCAGTAGAACACAAGT 57.863 40.909 0.00 0.00 0.00 3.16
2308 2341 3.751175 GTGGCTCATAAGTAGTTGCACAA 59.249 43.478 0.00 0.00 0.00 3.33
2325 2358 1.480137 CTAGCTAGTTGCAGAGTGGCT 59.520 52.381 12.92 15.15 46.09 4.75
2605 2638 4.338964 ACAACATTGAGCTGATGAACAACA 59.661 37.500 12.36 0.00 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.